ACOT9-acyl-CoA thioesterase 9 Gene View larger

ACOT9-acyl-CoA thioesterase 9 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACOT9-acyl-CoA thioesterase 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACOT9-acyl-CoA thioesterase 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012573
Product type: DNA & cDNA
Ncbi symbol: ACOT9
Origin species: Human
Product name: ACOT9-acyl-CoA thioesterase 9 Gene
Size: 2ug
Accessions: BC012573
Gene id: 23597
Gene description: acyl-CoA thioesterase 9
Synonyms: ACATE2; CGI-16; MT-ACT48; MTACT48; acyl-coenzyme A thioesterase 9, mitochondrial; acyl-CoA thioester hydrolase 9; acyl-Coenzyme A thioesterase 2, mitochondrial; mitochondrial Acyl-CoA Thioesterase; acyl-CoA thioesterase 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcgggcagcactgcggctttgtgccttgggcaaagggcagcttactcctggaagaggactgactcaaggaccccagaaccccaagaaacagggaatcttccacattcatgaagttcgagataagttgcgggagatagtaggagcatccacaaactggagagaccatgtgaaggcaatggaagaaaggaaattacttcatagtttcttggctaaatcacaggatggactgcctcctaggagaatgaaggacagttatattgaagttctcttgcctttgggcagtgagcctgaattacgagagaaatatttgactgttcaaaacaccgtaagatttggcaggattcttgaggatcttgacagcttgggagttcttatttgttacatgcacaacaaaatccactccgccaagatgtctcctttatcgatagttacagccctggtggataagattgatatgtgtaagaagagcttgagcccagaacaggacattaagttcagtggccatgttagctgggtcgggaagacatccatggaagtgaagatgcaaatgttccagttacatggtgatgaattttgtcctgttttggatgcaacatttgtaatggtggctcgtgattctgaaaataaagggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - elastase 3A, pancreatic
- elastase 3B, pancreatic
- ovo-like 2 (Drosophila)
- insulin induced gene 1

Buy ACOT9-acyl-CoA thioesterase 9 Gene now

Add to cart