ELA3B-elastase 3B, pancreatic Gene View larger

ELA3B-elastase 3B, pancreatic Gene

PTXBC005216

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELA3B-elastase 3B, pancreatic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELA3B-elastase 3B, pancreatic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005216
Product type: DNA & cDNA
Ncbi symbol: ELA3B
Origin species: Human
Product name: ELA3B-elastase 3B, pancreatic Gene
Size: 2ug
Accessions: BC005216
Gene id: 23436
Gene description: elastase 3B, pancreatic
Synonyms: ELA3B; CBPP; chymotrypsin-like elastase family member 3B; cholesterol-binding pancreatic protease; elastase 3B, pancreatic; elastase IIIB; elastase-3B; fecal elastase 1; pancreatic elastase 1; pancreatic endopeptidase E; protease E; proteinase E; chymotrypsin like elastase family member 3B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgctccggctgctcagttccctcctccttgtggccgttgcctcaggctatggcccaccttcctctcgcccttccagccgcgttgtcaatggtgaggatgcggtcccctacagctggccctggcaggtttccctgcagtatgagaaaagtggaagcttctaccacacgtgtggcggtagcctcatcgcccccgactgggttgtgactgccggccactgcatctcgagctcctggacctaccaggtggtgttgggcgagtacgaccgtgctgtgaaggagggccccgagcaggtgatccccatcaactctggggacctctttgtgcatccactctggaaccgctcgtgtgtggcctgtggcaatgacatcgccctcatcaagctctcacgcagcgcccagctgggagacgccgtccagctcgcctcactccctcccgctggtgacatccttcccaacgagacaccctgctacatcaccggctggggccgtctctataccaacgggccactcccagacaagctgcaggaggccctgctgcccgtggtggactatgaacactgctccaggtggaactggtggggttcctccgtgaagaagaccatggtgtgtgctggaggggacatccgctccggctgcaacggtgactctggaggacccctcaactgccccacagaggatggtggctggcaggtccatggcgtgaccagctttgtttctgcctttggctgcaacacccgcaggaagcccacggtgttcactcgagtctccgccttcatcgactggattgaggagaccatagcaagccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ovo-like 2 (Drosophila)
- insulin induced gene 1
- paraspeckle component 1
- enolase 3 (beta, muscle)

Buy ELA3B-elastase 3B, pancreatic Gene now

Add to cart