INSIG1-insulin induced gene 1 Gene View larger

INSIG1-insulin induced gene 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INSIG1-insulin induced gene 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about INSIG1-insulin induced gene 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001880
Product type: DNA & cDNA
Ncbi symbol: INSIG1
Origin species: Human
Product name: INSIG1-insulin induced gene 1 Gene
Size: 2ug
Accessions: BC001880
Gene id: 3638
Gene description: insulin induced gene 1
Synonyms: CL6; insulin-induced gene 1 protein; INSIG-1 membrane protein; insulin induced gene 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccagattgcacgaccacttctggagctgctcctgtgcgcacagcgcgaggcgccgaggccccccgcgagccagcgccgcggggctggcggccaaggttggggagatgatcaacgtttccgtgtccgggccctccctgctggcggcccacggtgccccggacgctgaccccgcgcccaggggccgcagtgctgcgatgagcggccccgagcccggcagcccctaccccaacacctggcatcatcgcctgttgcagaggagcctcgtgctcttctcggttggggtggtcctagccctggtgctcaacctgctgcagatccagaggaatgtcactctcttccccgaggaggtgatcgccaccatcttttcctccgcctggtgggtccctccctgctgcgggacagcagctgctgttgttggcctactgtacccctgtatcgacagtcacctcggagaaccccacaaatttaagagagaatgggccagtgtcatgcgctgcatagcagtttttgttggcattaaccacgccagtgctaaattggattttgccaataatgtccagctgtccttgactttagcagccctatctttgggcctttggtggacatttgatcgttccagaagtggccttgggctggggatcaccatagcttttctagctacgctgatcacgcagtttctcgtgtataatggtgtctatcagtatacatccccagatttcctctatattcgttcttggctcccttgtatatttttctcaggaggcgtcacggtggggaacataggacgacagttagctatgggtgttcctgaaaagccccatagtgattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - paraspeckle component 1
- enolase 3 (beta, muscle)
- aspartyl aminopeptidase
- aspartyl-tRNA synthetase

Buy INSIG1-insulin induced gene 1 Gene now

Add to cart