Login to display prices
Login to display prices
OVOL2-ovo-like 2 (Drosophila) Gene View larger

OVOL2-ovo-like 2 (Drosophila) Gene

PTXBC006148

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OVOL2-ovo-like 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OVOL2-ovo-like 2 (Drosophila) Gene

Proteogenix catalog: PTXBC006148
Ncbi symbol: OVOL2
Product name: OVOL2-ovo-like 2 (Drosophila) Gene
Size: 2ug
Accessions: BC006148
Gene id: 58495
Gene description: ovo-like 2 (Drosophila)
Synonyms: EUROIMAGE566589; PPCD1; ZNF339; transcription factor Ovo-like 2; zinc finger protein 339; ovo like zinc finger 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaaagtcttcctggtgaagaggaggagcctgggggtctcggtccgcagctgggatgagctcccggatgagaaaagggcagacacctacatcccagtgggcctaggccgcctgctccacgacccccccgaggactgccgcagcgacggcggcagcagcagcggcagcggcagcagcagcgcgggggagcctggaggagcagagagcagctcgtccccgcacgcccccgagagcgaaacccccgagcccggcgacgccgagggccccgatggacacctggcgaccaagcagcgcccggtcgccagatcgaaaatcaagttcaccacaggcacgtgcagcgactcggtggttcacagctgtgacctgtgtggcaagggcttccgtctgcagcgcatgctgaaccgtcacctcaagtgccacaaccaggtgaaaagacacctgtgcaccttctgcggcaagggcttcaacgacaccttcgacctgaagaggcacgtccgcacacacacaggcattcgtccctacaaatgcaacgtctgcaataaagccttcacccagcgctgctctctggagtcccacctgaagaaaatccatggggtgcagcagcagtatgcctataagcagcggcgggacaagctctacgtctgcgaggattgcggctacacgggccccacccaggaggacctgtacctgcacgtgaacagtgcccatccgggcagctcgtttctcaaaaagacatctaaaaaactggcagcccttctgcagggcaagctgacatccgcacaccaggagaataccagcctgagtgaggaggaggagaggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: