OVOL2-ovo-like 2 (Drosophila) Gene View larger

OVOL2-ovo-like 2 (Drosophila) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OVOL2-ovo-like 2 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OVOL2-ovo-like 2 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006148
Product type: DNA & cDNA
Ncbi symbol: OVOL2
Origin species: Human
Product name: OVOL2-ovo-like 2 (Drosophila) Gene
Size: 2ug
Accessions: BC006148
Gene id: 58495
Gene description: ovo-like 2 (Drosophila)
Synonyms: EUROIMAGE566589; PPCD1; ZNF339; transcription factor Ovo-like 2; zinc finger protein 339; ovo like zinc finger 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaaagtcttcctggtgaagaggaggagcctgggggtctcggtccgcagctgggatgagctcccggatgagaaaagggcagacacctacatcccagtgggcctaggccgcctgctccacgacccccccgaggactgccgcagcgacggcggcagcagcagcggcagcggcagcagcagcgcgggggagcctggaggagcagagagcagctcgtccccgcacgcccccgagagcgaaacccccgagcccggcgacgccgagggccccgatggacacctggcgaccaagcagcgcccggtcgccagatcgaaaatcaagttcaccacaggcacgtgcagcgactcggtggttcacagctgtgacctgtgtggcaagggcttccgtctgcagcgcatgctgaaccgtcacctcaagtgccacaaccaggtgaaaagacacctgtgcaccttctgcggcaagggcttcaacgacaccttcgacctgaagaggcacgtccgcacacacacaggcattcgtccctacaaatgcaacgtctgcaataaagccttcacccagcgctgctctctggagtcccacctgaagaaaatccatggggtgcagcagcagtatgcctataagcagcggcgggacaagctctacgtctgcgaggattgcggctacacgggccccacccaggaggacctgtacctgcacgtgaacagtgcccatccgggcagctcgtttctcaaaaagacatctaaaaaactggcagcccttctgcagggcaagctgacatccgcacaccaggagaataccagcctgagtgaggaggaggagaggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - insulin induced gene 1
- paraspeckle component 1
- enolase 3 (beta, muscle)
- aspartyl aminopeptidase

Buy OVOL2-ovo-like 2 (Drosophila) Gene now

Add to cart