Login to display prices
Login to display prices
ELA3A-elastase 3A, pancreatic Gene View larger

ELA3A-elastase 3A, pancreatic Gene

PTXBC007028

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELA3A-elastase 3A, pancreatic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELA3A-elastase 3A, pancreatic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007028
Product type: DNA & cDNA
Ncbi symbol: ELA3A
Origin species: Human
Product name: ELA3A-elastase 3A, pancreatic Gene
Size: 2ug
Accessions: BC007028
Gene id: 10136
Gene description: elastase 3A, pancreatic
Synonyms: ELA3A; ELA3; chymotrypsin-like elastase family member 3A; elastase 1; elastase 3A, pancreatic; elastase IIIA; elastase-3A; protease E; chymotrypsin like elastase family member 3A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgctccggctgctcagttccctcctccttgtggccgttgcctcaggctatggcccaccttcctctcactcttccagccgcgttgtccatggtgaggatgcggtcccctacagctggccctggcaggtttccctgcagtatgagaaaagtggaagcttctaccacacgtgtggcggtagcctcatcgcccccgattgggttgtgactgccggccactgcatctcgagggatctgacctaccaggtggtgttgggtgagtacaaccttgctgtgaaggagggccccgagcaggtgatccccatcaactctgaggagctgtttgtgcatccactctggaaccgctcgtgtgtggcctgtggcaatgacatcgccctcatcaagctctcacgcagcgcccagctgggagatgccgtccagctcgcctcactccctcccgctggtgacatccttcccaacaagacaccctgctacatcaccggctggggccgtctctataccaatgggccactcccagacaagctgcagcaggcccggctgcccgtggtggactataagcactgctccaggtggaactggtggggttccaccgtgaagaaaaccatggtgtgtgctggagggtacatccgctccggctgcaacggtgactctggaggacccctcaactgccccacagaggatggtggctggcaggtccacggtgtgaccagctttgtttctggctttggctgcaacttcatctggaagcctacagtgttcactcgagtctccgccttcatcgactggattgaggagaccatagcaagccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - elastase 3B, pancreatic
- ovo-like 2 (Drosophila)
- insulin induced gene 1
- paraspeckle component 1