PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene View larger

PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013360
Product type: DNA & cDNA
Ncbi symbol: PPP1R8
Origin species: Human
Product name: PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene
Size: 2ug
Accessions: BC013360
Gene id: 5511
Gene description: protein phosphatase 1, regulatory (inhibitor) subunit 8
Synonyms: ARD-1; ARD1; NIPP-1; NIPP1; PRO2047; nuclear inhibitor of protein phosphatase 1; RNase E; activator of RNA decay; nuclear inhibitor of protein phosphatase-1 alpha; nuclear inhibitor of protein phosphatase-1 beta; nuclear subunit of PP-1; protein phosphatase 1, regulatory (inhibitor) subunit 8; protein phosphatase 1 regulatory subunit 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtggagaggatgatgaactcaagggcttactggggcttccagaggaggaaactgagcttgataacctgacagagttcaacactgcccacaacaagcggatttctacccttaccattgaggagggaaatctggacattcaaagaccaaagaggaagaggaagaactcacgggtgacattcagtgaggatgatgagatcatcaacccagaggatgtggatccctcagttggtcgattcaggaacatggtgcaaactgcagtggtcccagtcaagaagaagcgtgtggagggccctggctccctgggcctggaggaatcagggagcaggcgcatgcagaactttgccttcagcggaggactctacgggggcctgccccccacacacagtgaagcaggctcccagccacatggcatccatgggacagcactcatcggtggcttgcccatgccatacccaaaccttgcccctgatgtggacttgactcctgttgtgccgtcagcagtgaacatgaaccctgcaccaaaccctgcagtctataaccctgaagctgtaaatgaacccaagaagaagaaatatgcaaaagaggcttggccaggcaagaagcccacaccttccttgctgatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil-helix-coiled-coil-helix domain containing 6
- major histocompatibility complex, class II, DP beta 1
- major histocompatibility complex, class II, DP beta 1
- major histocompatibility complex, class II, DQ beta 1

Buy PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene now

Add to cart