PTXBC013360
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC013360 |
Product type: | DNA & cDNA |
Ncbi symbol: | PPP1R8 |
Origin species: | Human |
Product name: | PPP1R8-protein phosphatase 1, regulatory (inhibitor) subunit 8 Gene |
Size: | 2ug |
Accessions: | BC013360 |
Gene id: | 5511 |
Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 8 |
Synonyms: | ARD-1; ARD1; NIPP-1; NIPP1; PRO2047; nuclear inhibitor of protein phosphatase 1; RNase E; activator of RNA decay; nuclear inhibitor of protein phosphatase-1 alpha; nuclear inhibitor of protein phosphatase-1 beta; nuclear subunit of PP-1; protein phosphatase 1, regulatory (inhibitor) subunit 8; protein phosphatase 1 regulatory subunit 8 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggtggagaggatgatgaactcaagggcttactggggcttccagaggaggaaactgagcttgataacctgacagagttcaacactgcccacaacaagcggatttctacccttaccattgaggagggaaatctggacattcaaagaccaaagaggaagaggaagaactcacgggtgacattcagtgaggatgatgagatcatcaacccagaggatgtggatccctcagttggtcgattcaggaacatggtgcaaactgcagtggtcccagtcaagaagaagcgtgtggagggccctggctccctgggcctggaggaatcagggagcaggcgcatgcagaactttgccttcagcggaggactctacgggggcctgccccccacacacagtgaagcaggctcccagccacatggcatccatgggacagcactcatcggtggcttgcccatgccatacccaaaccttgcccctgatgtggacttgactcctgttgtgccgtcagcagtgaacatgaaccctgcaccaaaccctgcagtctataaccctgaagctgtaaatgaacccaagaagaagaaatatgcaaaagaggcttggccaggcaagaagcccacaccttccttgctgatttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - coiled-coil-helix-coiled-coil-helix domain containing 6 - major histocompatibility complex, class II, DP beta 1 - major histocompatibility complex, class II, DP beta 1 - major histocompatibility complex, class II, DQ beta 1 |