Login to display prices
Login to display prices
ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene View larger

ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene

PTXBC016703

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene

Proteogenix catalog: PTXBC016703
Ncbi symbol: ACSM5
Product name: ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene
Size: 2ug
Accessions: BC016703
Gene id: 54988
Gene description: acyl-CoA synthetase medium-chain family member 5
Synonyms: acyl-coenzyme A synthetase ACSM5, mitochondrial; acyl-CoA synthetase medium-chain family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaccatggctgagacacctagtcctccaggcactgaggaactccagggcattctgtgggtctcatgggaagccagcacctctacctgttcctcagaagatcgtggccacctgggaagccatcagcctgggaaggcagctggtgcctgagtacttcaacttcgcccatgatgtgctggatgtgtggagtcggctggaagaggctggacaccgccccccaaatcctgccttctggtgggtcaatggcacaggagcagagatcaagtggagctttgaggagctggggaagcagtccaggaaggcagccaatgtgctggggggtgcatgcggcctgcagcctggggacagaatgatgctggtactcccacggctcccggagtggtggctggtcagtgtggcttgcatgcggacagggactgtggtgattccgggtgtgactcagctgacagagaaggacctcaagtaccggctgcaggcgtccagggccaagtccattatcaccagtgactccctagctccaagggtggatgccatcagtgccgaatgcccctccctccagaccaagctgctggtgtcagacagcagtcggccaggctggttgaacttcagggaactcctccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: