ARC-activity-regulated cytoskeleton-associated protein Gene View larger

ARC-activity-regulated cytoskeleton-associated protein Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARC-activity-regulated cytoskeleton-associated protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARC-activity-regulated cytoskeleton-associated protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012321
Product type: DNA & cDNA
Ncbi symbol: ARC
Origin species: Human
Product name: ARC-activity-regulated cytoskeleton-associated protein Gene
Size: 2ug
Accessions: BC012321
Gene id: 23237
Gene description: activity-regulated cytoskeleton-associated protein
Synonyms: ARC/ARG3.1; Arg3.1; activity-regulated cytoskeleton-associated protein; activity-regulated gene 3.1 protein homolog; activity regulated cytoskeleton associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctggaccaccggaccagcggcgggctccacgcctaccccgggccgcggggcgggcaggtggccaagcccaacgtgatcctgcagatcgggaagtgccgggccgagatgctggagcacgtgcggcggacgcaccggcacctgctggccgaggtgtccaagcaggtggagcgcgagctgaaggggctgcaccggtcggtcgggaagctggagagcaacctggacggctacgtgcccacgagcgactcgcagcgctggaagaagtccatcaaggcctgcctgtgccgctgccaggagaccatcgccaacctggagcgctgggtcaagcgcgagatgcacgtgtggcgcgaggtgttctaccgcctggagcgctgggccgaccgcctggagtccacgggcggcaagtacccggtgggcagcgagtcagcccgccacaccgtttccgtgggcgtggggggtcccgagagctactgccacgaggcagacggctacgactacaccgtcagcccctacgccatcaccccgcccccagccgctggcgagctgcccgggcaggagcccgccgaggcccagcagtaccagccgtgggtccccggcgaggacgggcagcccagccccggcgtggacacgcagatcttcgaggaccctcgagagttcctgagccacctagaggagtacttgcggcaggtgggcggctctgaggagtactggctgtcccagatccagaatcacatgaacgggccggccaagaagtggtgggagttcaagcagggctccgtgaagaactgggtggagttcaagaaggagttcctgcagtacagcgagggcacgctgtcccgagaggccatccagcgggagctggacctgccgcagaagcagggcgagccgctggaccagttcctgtggcgcaagcgggacctgtaccagacgctctacgtggacgcggacgaggaggagatcatccagtacgtggtgggcaccctgcagcccaagctcaagcgtttcctgcgccaccccctgcccaagaccctggagcagctcatccagaggggcatggaggtgcaggatgacctggagcaggcggccgagccggccggcccccacctcccggtggaggatgaggcggagaccctcacgcccgcccccaacagcgagtccgtggccagtgaccggacccagcccgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
- euchromatic histone-lysine N-methyltransferase 2
- leptin receptor overlapping transcript-like 1
- calcium regulated heat stable protein 1, 24kDa

Buy ARC-activity-regulated cytoskeleton-associated protein Gene now

Add to cart