LEPROTL1-leptin receptor overlapping transcript-like 1 Gene View larger

LEPROTL1-leptin receptor overlapping transcript-like 1 Gene

PTXBC000642

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LEPROTL1-leptin receptor overlapping transcript-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LEPROTL1-leptin receptor overlapping transcript-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000642
Product type: DNA & cDNA
Ncbi symbol: LEPROTL1
Origin species: Human
Product name: LEPROTL1-leptin receptor overlapping transcript-like 1 Gene
Size: 2ug
Accessions: BC000642
Gene id: 23484
Gene description: leptin receptor overlapping transcript-like 1
Synonyms: HSPC112; Vps55; my047; leptin receptor overlapping transcript-like 1; endospanin-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggcatcaaagctttgattagtttgtcctttggaggagcaatcggactgatgtttttgatgcttggatgtgcccttccaatatacaacaaatactggcccctctttgttctatttttttacatcctttcacctattccatactgcatagcaagaagattagtggatgatacagatgctatgagtaacgcttgtaaggaacttgccatctttcttacaacgggcattgtcgtgtcagcttttggactccctattgtatttgccagagcacatctgattgagtggggagcttgtgcacttgttctcacaggaaacacagtcatctttgcaactatactaggctttttcttggtctttggaagcaatgacgacttcagctggcagcagtggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcium regulated heat stable protein 1, 24kDa
- MAP kinase interacting serine/threonine kinase 2
- tumor necrosis factor, alpha-induced protein 8
- acyl-CoA synthetase medium-chain family member 5

Buy LEPROTL1-leptin receptor overlapping transcript-like 1 Gene now

Add to cart