Login to display prices
Login to display prices
LEPROTL1-leptin receptor overlapping transcript-like 1 Gene View larger

LEPROTL1-leptin receptor overlapping transcript-like 1 Gene

PTXBC000642

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LEPROTL1-leptin receptor overlapping transcript-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LEPROTL1-leptin receptor overlapping transcript-like 1 Gene

Proteogenix catalog: PTXBC000642
Ncbi symbol: LEPROTL1
Product name: LEPROTL1-leptin receptor overlapping transcript-like 1 Gene
Size: 2ug
Accessions: BC000642
Gene id: 23484
Gene description: leptin receptor overlapping transcript-like 1
Synonyms: HSPC112; Vps55; my047; leptin receptor overlapping transcript-like 1; endospanin-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggcatcaaagctttgattagtttgtcctttggaggagcaatcggactgatgtttttgatgcttggatgtgcccttccaatatacaacaaatactggcccctctttgttctatttttttacatcctttcacctattccatactgcatagcaagaagattagtggatgatacagatgctatgagtaacgcttgtaaggaacttgccatctttcttacaacgggcattgtcgtgtcagcttttggactccctattgtatttgccagagcacatctgattgagtggggagcttgtgcacttgttctcacaggaaacacagtcatctttgcaactatactaggctttttcttggtctttggaagcaatgacgacttcagctggcagcagtggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: