CARHSP1-calcium regulated heat stable protein 1, 24kDa Gene View larger

CARHSP1-calcium regulated heat stable protein 1, 24kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CARHSP1-calcium regulated heat stable protein 1, 24kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CARHSP1-calcium regulated heat stable protein 1, 24kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003366
Product type: DNA & cDNA
Ncbi symbol: CARHSP1
Origin species: Human
Product name: CARHSP1-calcium regulated heat stable protein 1, 24kDa Gene
Size: 2ug
Accessions: BC003366
Gene id: 23589
Gene description: calcium regulated heat stable protein 1, 24kDa
Synonyms: CRHSP-24; CRHSP24; CSDC1; calcium-regulated heat-stable protein 1; calcium regulated heat stable protein 1, 24kDa; calcium-regulated heat-stable protein (24kD); calcium-regulated heat-stable protein of 24 kDa; calcium regulated heat stable protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcatctgagcctcccccaccaccacagccccccacccatcaagcttcagtcgggctgctggacacccctcggagccgtgagcgctcaccatcccctctgcgcggcaacgtggtcccaagcccactgcccactcgccggacgaggaccttctcggcgacggtgcgggcttcacagggccccgtctacaaaggagtctgcaaatgcttctgccggtccaagggccatggcttcattaccccagctgatggcggccccgacatcttcctgcacatctctgatgtggaaggggagtatgtcccagtggaaggcgacgaggtcacctataaaatgtgctccatcccacccaagaatgagaagctgcaggccgtggaggtcgtcatcactcacctggcaccaggcaccaagcatgagacctggtctggacatgtcatcagctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MAP kinase interacting serine/threonine kinase 2
- tumor necrosis factor, alpha-induced protein 8
- acyl-CoA synthetase medium-chain family member 5
- small nuclear ribonucleoprotein polypeptide B''

Buy CARHSP1-calcium regulated heat stable protein 1, 24kDa Gene now

Add to cart