Login to display prices
Login to display prices
MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene View larger

MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018345
Product type: DNA & cDNA
Ncbi symbol: MKNK2
Origin species: Human
Product name: MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene
Size: 2ug
Accessions: BC018345
Gene id: 2872
Gene description: MAP kinase interacting serine/threonine kinase 2
Synonyms: GPRK7; MNK2; MAP kinase-interacting serine/threonine-protein kinase 2; G protein-coupled receptor kinase 7; MAP kinase signal-integrating kinase 2; MAPK signal-integrating kinase 2; MAP kinase interacting serine/threonine kinase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccggaggtagtggaggccttcagcgaggaggctagcatctacgacaagcgctgcgacctgtggagcctgggcgtcatcttgtatatcctactcagcggctacccgcccttcgtgggccgctgtggcagcgactgcggctgggaccgcggcgaggcctgccctgcctgccagaacatgctgtttgagagcatccaggagggcaagtacgagttccccgacaaggactgggcccacatctcctgcgctgccaaagacctcatctccaagctgctggtccgtgacgccaagcagaggctgagtgccgcccaagtcctgcagcacccctgggttcaggggtgcgccccggagaacaccttgcccactcccatggtcctgcagaggtgggacagtcacttcctcctccctccccacccctgtcgcatccacgtgcgacctggaggactggtcagaaccgttactgtgaatgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor, alpha-induced protein 8
- acyl-CoA synthetase medium-chain family member 5
- small nuclear ribonucleoprotein polypeptide B''
- TCF3 (E2A) fusion partner (in childhood Leukemia)