Login to display prices
Login to display prices
MCCC1-methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) Gene View larger

MCCC1-methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) Gene


New product

Data sheet of MCCC1-methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MCCC1-methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004187
Product type: DNA & cDNA
Ncbi symbol: MCCC1
Origin species: Human
Product name: MCCC1-methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) Gene
Size: 2ug
Accessions: BC004187
Gene id: 56922
Gene description: methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Synonyms: MCC-B; MCCA; methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial; 3-methylcrotonyl-CoA carboxylase 1; 3-methylcrotonyl-CoA carboxylase biotin-containing subunit; 3-methylcrotonyl-CoA:carbon dioxide ligase subunit alpha; MCCase subunit alpha; methylcrotonoyl-CoA carboxylase 1 (alpha); methylcrotonoyl-CoA carboxylase alpha; methylcrotonoyl-Coenzyme A carboxylase 1 (alpha); methylcrotonoyl-CoA carboxylase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcctctgcggtgtcggtgctgctggtggcggcggagaggaaccggtggcatcgtctcccgagcctgctcctgccgccgaggacatgggtgtggaggcaaagaaccatgaagtacacaacagccacaggaagaaacattaccaaggtcctcattgcaaacagaggagaaattgcctgcagggtgatgcgcacagccaaaaaactgggtgtacagactgtggcggtttatagtgaggctgacagaaattccatgcatgtagatatggcagatgaagcatattccatcggccccgctccctcccagcagagctacctatctatggagaaaatcattcaagtggccaagacctctgctgcacaggctatccatccaggatgcggttttctttcagaaaacatggaatttgctgaactttgtaagcaagaaggaattatttttataggccctcctccatctgcaattagagacatgggtataaagagcacatccaaatccataatggctgctgctggagtacctgttgtggagggttatcatggtgaggaccaatcagaccagtgcctgaaggaacacgccaggagaattggctatcctgtcatgattaaagccgtccggggtggaggaggaaaaggaatgaggattgttagatcagaacaagaatttcaagaacagttagagtcagcacggagagaagctaagaagtctttcaatgatgatgctatgctgatcgagaagtttgtagacacaccgaggcatgtagaagtccaggtgtttggtgatcaccatggcaatgctgtgtacttgtttgaaagagactgtagtgtgcagaggcgacatcagaagatcattgaggaggccccagcgcctggtattaaatctgaagtaagaaaaaagctgggagaagctgcagtcagagctgctaaagctgtaaattatgttggagcagggactgtggagtttattatggactcaaaacataatttctgtttcatggagatgaatacaaggctgcaagtggaacatcctgttactgagatgatcacaggaactgacttggtggagtggcagcttagaattgcagcaggagagaagattcctttgagccaggaagaaataactctgcagggccatgccttcgaagctagaatatatgcagaagatcctagcaataacttcatgcctgtggcaggcccattagtgcacctctctactcctcgagcagacccttccaccaggattgaaactggagtacggcaaggagacgaagtttccgtgcattatgaccccatgattgcgaagctggtcgtgtgggcagcagatcgccaggcggcattgacaaaactgaggtacagccttcgtcagtacaatattgttggactgcccaccaacattgacttcttactcaacctgtctggccacccagagtttgaagctgggaacgtgcacactgatttcatccctcaacaccacaaacagttgttgctcagtcggaaggctgcagccaaagagtctttatgccaggcagccctgggtctcatcctcaaggagaaagccatgaccgacactttcactcttcaggcacatgatcaattctctccattttcgtctagcagtggaagaagactgaatatctcgtataccagaaacatgactcttaaagatggtaaaaacaatgtagccatagctgtaacgtataaccatgatgggtcttatagcatgcagattgaagataaaactttccaagtccttggtaatctttacagcgagggagactgcacttacctgaaatgttctgttaatggagttgctagtaaagcgaagctgattatcctggaaaacactatttacctattttccaaggaaggaagtattgagattgacattccagtccccaaatacttatcttctgtgagctcacaagaaactcagggcggccccttagctcctatgactggaaccattgaaaaggtgtttgtcaaagctggagacaaagtgaaagcgggagattccctcatggttatgatcgccatgaagatggagcataccataaagtctccaaaggatggcacagtaaagaaagtgttctacagagaaggtgctcaggccaacagacacactcctttagtcgagtttgaggaggaagaatcagacaaaagggaatcggaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - euchromatic histone-lysine N-methyltransferase 2
- leptin receptor overlapping transcript-like 1
- calcium regulated heat stable protein 1, 24kDa
- MAP kinase interacting serine/threonine kinase 2