Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000006 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP1B1 |
| Origin species: | Human |
| Product name: | ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC000006 |
| Gene id: | 481 |
| Gene description: | ATPase, Na+/K+ transporting, beta 1 polypeptide |
| Synonyms: | ATP1B; sodium/potassium-transporting ATPase subunit beta-1; ATPase, Na+/K+ transporting, beta 1 polypeptide; Beta 1-subunit of Na(+),K(+)-ATPase; Na, K-ATPase beta-1 polypeptide; adenosinetriphosphatase; sodium pump subunit beta-1; sodium-potassium ATPase subunit beta 1 (non-catalytic); sodium/potassium-dependent ATPase beta-1 subunit; sodium/potassium-transporting ATPase beta-1 chain; ATPase Na+/K+ transporting subunit beta 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgcgggaaagccaaggaggagggcagctggaagaaattcatctggaactcagagaagaaggagtttctgggcaggaccggtggcagttggtttaagatccttctattctacgtaatattttatggctgcctggctggcatcttcatcggaaccatccaagtgatgctgctcaccatcagtgaatttaagcccacatatcaggaccgagtggccccgccaggattaacacagattcctcagatccagaagactgaaatttcctttcgtcctaatgatcccaagagctatgaggcatatgtactgaacatagttaggttcctggaaaagtacaaagattcagcccagagggatgacatgatttttgaagattgtggcgatgtgcccagtgaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaagttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - activity-regulated cytoskeleton-associated protein - methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) - euchromatic histone-lysine N-methyltransferase 2 - leptin receptor overlapping transcript-like 1 |