ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene View larger

ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene

PTXBC000006

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000006
Product type: DNA & cDNA
Ncbi symbol: ATP1B1
Origin species: Human
Product name: ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene
Size: 2ug
Accessions: BC000006
Gene id: 481
Gene description: ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms: ATP1B; sodium/potassium-transporting ATPase subunit beta-1; ATPase, Na+/K+ transporting, beta 1 polypeptide; Beta 1-subunit of Na(+),K(+)-ATPase; Na, K-ATPase beta-1 polypeptide; adenosinetriphosphatase; sodium pump subunit beta-1; sodium-potassium ATPase subunit beta 1 (non-catalytic); sodium/potassium-dependent ATPase beta-1 subunit; sodium/potassium-transporting ATPase beta-1 chain; ATPase Na+/K+ transporting subunit beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgcgggaaagccaaggaggagggcagctggaagaaattcatctggaactcagagaagaaggagtttctgggcaggaccggtggcagttggtttaagatccttctattctacgtaatattttatggctgcctggctggcatcttcatcggaaccatccaagtgatgctgctcaccatcagtgaatttaagcccacatatcaggaccgagtggccccgccaggattaacacagattcctcagatccagaagactgaaatttcctttcgtcctaatgatcccaagagctatgaggcatatgtactgaacatagttaggttcctggaaaagtacaaagattcagcccagagggatgacatgatttttgaagattgtggcgatgtgcccagtgaaccgaaagaacgaggagactttaatcatgaacgaggagagcgaaaggtctgcagattcaagcttgaatggctgggaaattgctctggattaaatgatgaaacttatggctacaaagagggcaaaccgtgcattattataaagctcaaccgagttctaggcttcaaacctaagcctcccaagaatgagtccttggagacttacccagtgatgaagtataacccaaatgtccttcccgttcagtgcactggcaagcgagatgaagataaggataaagttggaaatgtggagtattttggactgggcaactcccctggttttcctctgcagtattatccgtactatggcaaactcctgcagcccaaatacctgcagcccctgctggccgtacagttcaccaatcttaccatggacactgaaattcgcatagagtgtaaggcgtacggtgagaacattgggtacagtgagaaagaccgttttcagggacgttttgatgtaaaaattgaagttaagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - activity-regulated cytoskeleton-associated protein
- methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
- euchromatic histone-lysine N-methyltransferase 2
- leptin receptor overlapping transcript-like 1

Buy ATP1B1-ATPase, Na+/K+ transporting, beta 1 polypeptide Gene now

Add to cart