CDC42EP3-CDC42 effector protein (Rho GTPase binding) 3 Gene View larger

CDC42EP3-CDC42 effector protein (Rho GTPase binding) 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDC42EP3-CDC42 effector protein (Rho GTPase binding) 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDC42EP3-CDC42 effector protein (Rho GTPase binding) 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019270
Product type: DNA & cDNA
Ncbi symbol: CDC42EP3
Origin species: Human
Product name: CDC42EP3-CDC42 effector protein (Rho GTPase binding) 3 Gene
Size: 2ug
Accessions: BC019270
Gene id: 10602
Gene description: CDC42 effector protein (Rho GTPase binding) 3
Synonyms: BORG2; CEP3; UB1; cdc42 effector protein 3; CDC42 effector protein (Rho GTPase binding) 3; CRIB-containing BORG2 protein; MSE55-related Cdc42-binding protein; MSE55-related protein; binder of Rho GTPases 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagccaagaccccaatttacctgaaagcagccaataacaagaaaggaaagaaatttaaactgagggacattctgtctcctgatatgatcagtcccccgcttggagactttcgccacaccatccacattggcaaagagggccagcacgatgtctttggagatatttcctttcttcaagggaactacgagcttttacctggaaaccaggagaaagcacacctgggccagttccctgggcataatgagttcttccgggccaacagcacctcggactctgtgttcacagaaacgccctccccggtgctcaaaaatgccatctccctcccgaccattggaggatcccaagctctcatgttgcccttattgtcaccagtgacatttaattccaaacaggagtccttcgggccagcaaagctgcccaggcttagctgcgagcccgtcatggaggaaaaagctcaggagaaaagcagtctgttggagaatgggacagtccaccagggagacacctcgtggggctccagcggttctgcatctcagtccagccaaggcagagacagccactcctccagcctgtccgaacagtaccccgactggccagccgaggacatgtttgaccatcccaccccatgcgagctcatcaagggaaagactaagtcagaggagtccctctctgaccttacaggttccctcctctccctgcagcttgatcttgggccctcacttttggatgaggtgctgaatgtaatggataaaaataagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, Na+/K+ transporting, beta 1 polypeptide
- activity-regulated cytoskeleton-associated protein
- methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
- euchromatic histone-lysine N-methyltransferase 2

Buy CDC42EP3-CDC42 effector protein (Rho GTPase binding) 3 Gene now

Add to cart