C1orf50-chromosome 1 open reading frame 50 Gene View larger

C1orf50-chromosome 1 open reading frame 50 Gene

PTXBC001508

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf50-chromosome 1 open reading frame 50 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf50-chromosome 1 open reading frame 50 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001508
Product type: DNA & cDNA
Ncbi symbol: C1orf50
Origin species: Human
Product name: C1orf50-chromosome 1 open reading frame 50 Gene
Size: 2ug
Accessions: BC001508
Gene id: 79078
Gene description: chromosome 1 open reading frame 50
Synonyms: uncharacterized protein C1orf50; chromosome 1 open reading frame 50
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacgccgccgcgccggggcggaccgagggggtccttgaaaggcaaggagcgccgccagctgcaggccagggaggagccctggtggagctcaccccgacccccggcggcctggccctggtgagcccctaccacacccaccgggccggggaccccttagacctcgtggcgctcgcagagcaggtgcagaaggctgatgaattcatccgagcaaatgccaccaacaagctgacagtcatagctgagcaaatccaacatttgcaagaacaagccaggaaggtactggaagatgctcacagagatgccaacctgcaccatgtagcttgtaatatagtgaaaaaacctggcaacatttactatctctataaacgggagagtggtcagcagtatttttccatcatttctccaaaggaatgggggacaagttgtccacatgacttccttggtgcctacaaactacagcatgacttgtcctggactccgtatgaggacattgagaagcaagatgctaaaatcagcatgatggacatgttgctaagccagtcagtggccctgcctccgtgcactgaacccaacttccagggactgactcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 4 open reading frame 43
- mitochondrial ribosomal protein S26
- syntaxin binding protein 6 (amisyn)
- mitochondrial ribosomal protein L48

Buy C1orf50-chromosome 1 open reading frame 50 Gene now

Add to cart