C4orf43-chromosome 4 open reading frame 43 Gene View larger

C4orf43-chromosome 4 open reading frame 43 Gene

PTXBC011842

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C4orf43-chromosome 4 open reading frame 43 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C4orf43-chromosome 4 open reading frame 43 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011842
Product type: DNA & cDNA
Ncbi symbol: C4orf43
Origin species: Human
Product name: C4orf43-chromosome 4 open reading frame 43 Gene
Size: 2ug
Accessions: BC011842
Gene id: 55319
Gene description: chromosome 4 open reading frame 43
Synonyms: UPF0534 protein C4orf43; C4orf43; translation machinery-associated protein 16; translation machinery associated 16 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaaagcaccaaagggaaaaagtgcaggacgggaaaaaaaagtcatccatccatatagtagaaaagcagctcaaattacgagagaggcccacaaacaagaaaaaaaggaaaaattgaagaatgaaaaggccttgcgtctcaaccttgttggtgaaaaactgcaatggtttcaaaatcatcttgatcccccaaaaaagagatattcaaagaaagatgcttgtgaactaattgaaaggtacttaaatcgattcagcagtgagctggagcagattgagttacataacagtatcagggacaggcaggggaggcggcactgttcccgggagaccgtcatcaagcagacgatggagcgggagcgacagcagtttgagggatatggccttgagattccagacattctaaatgcaagtaatctgaaaacatttagggaatgggactttgatctgaagaaattaccaaacattaaaatgagaaaaatttgcgctaatgatgcaattcccaagacgtgcaagaggaaaactactataactgtagaccaagatttgggggaattggaactaaacgatgaatcaagtgattcagatgaggaaatgactgcagtggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S26
- syntaxin binding protein 6 (amisyn)
- mitochondrial ribosomal protein L48
- chorionic somatomammotropin hormone 2

Buy C4orf43-chromosome 4 open reading frame 43 Gene now

Add to cart