MRPL48-mitochondrial ribosomal protein L48 Gene View larger

MRPL48-mitochondrial ribosomal protein L48 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL48-mitochondrial ribosomal protein L48 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL48-mitochondrial ribosomal protein L48 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009764
Product type: DNA & cDNA
Ncbi symbol: MRPL48
Origin species: Human
Product name: MRPL48-mitochondrial ribosomal protein L48 Gene
Size: 2ug
Accessions: BC009764
Gene id: 51642
Gene description: mitochondrial ribosomal protein L48
Synonyms: CGI-118; HSPC290; L48MT; MRP-L48; 39S ribosomal protein L48, mitochondrial; mitochondrial ribosomal protein L48
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggaaccttgggaaaggtgctgtgcctgaggaacaataccatttttaagcaagccttttctctcttaaggtttagaacttcaggagagaagcccatctattctgtaggtggaattctactaagtatcagtcggccctacaagacaaagcccacccacggcattggaaagtacaagcacttaattaaagcagaagagcccaagaagaagaagggaaaagtggaagtgagagccattaatttggggacagattatgaatatggggttttaaatattcatctgactgcatatgatatgaccctggcagagagttatgcccagtatgttcacaacctctgcaactctctctccattaaagtcgaggaaagttatgcaatgccaaccaaaaccatagaagtgttgcagttgcaggaccaaggcagcaaaatgctcctggactcagtgcttaccacccatgagcgagtggttcagatcagcggtttgagtgctacgtttgcagaaattttcttggaaataatccaaagcagtcttcctgaaggagtcagactgtcagtgaaggagcacactgaagaagacttcaagggacgattcaaagctcgaccagaactggaagaactgttggccaagttgaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chorionic somatomammotropin hormone 2
- mitochondrial ribosomal protein S34
- epididymal sperm binding protein 1
- chromosome 7 open reading frame 36

Buy MRPL48-mitochondrial ribosomal protein L48 Gene now

Add to cart