Login to display prices
Login to display prices
ELSPBP1-epididymal sperm binding protein 1 Gene View larger

ELSPBP1-epididymal sperm binding protein 1 Gene

PTXBC015598

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELSPBP1-epididymal sperm binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELSPBP1-epididymal sperm binding protein 1 Gene

Proteogenix catalog: PTXBC015598
Ncbi symbol: ELSPBP1
Product name: ELSPBP1-epididymal sperm binding protein 1 Gene
Size: 2ug
Accessions: BC015598
Gene id: 64100
Gene description: epididymal sperm binding protein 1
Synonyms: E12; EDDM12; EL149; HE12; epididymal sperm-binding protein 1; epididymal protein 12; epididymal secretory protein 12; epididymis luminal secretory protein 149; epididymal sperm binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccgatggtccagttacctgttgggatggacaaccttccttctctattcctatgagtcaagtggagggatgcatgaggaatgtgtctttcctttcacctacaagggatctgtttacttcacttgcacccatattcatagcttatccccttggtgtgccaccagagccgtgtacaacggccagtggaagtactgccagagtgaagattacccacgctgtatcttccctttcatctatcgaggaaaggcttataacagctgcatctcccagggcagcttcttaggcagtctgtggtgctcagtcacctctgtcttcgatgagaaacagcagtggaaattctgtgaaacgaatgagtatgggggaaattctctcaggaagccctgcatcttcccctccatctacagaaataatgtggtctctgattgcatggaggatgaaagcaacaagctctggtgcccaaccacagagaacatggataaggatggaaagtggagtttctgtgccgacaccagaatttccgcgttggtccctggctttccttgtcactttccgttcaactataaaaacaagaattattttaactgcactaacaaaggatcaaaggagaaccttgtgtggtgtgcaacttcttacaactacgaccaagaccacacctgggtgtattgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: