C7orf36-chromosome 7 open reading frame 36 Gene View larger

C7orf36-chromosome 7 open reading frame 36 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf36-chromosome 7 open reading frame 36 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf36-chromosome 7 open reading frame 36 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022043
Product type: DNA & cDNA
Ncbi symbol: C7orf36
Origin species: Human
Product name: C7orf36-chromosome 7 open reading frame 36 Gene
Size: 2ug
Accessions: BC022043
Gene id: 57002
Gene description: chromosome 7 open reading frame 36
Synonyms: C7orf36; GK003; yae1 domain-containing protein 1; Yae1 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtgggttcaagcagcctccttgatccagggccctggagacaaaggggacgtgtttgaggaagaagcagacgagtcgctcctggcgcagcgggaatggcagagtaacatgcaaagacgagtcaaagaaggttatagagatggaatagatgctggcaaagcagttactcttcaacagggcttcaatcaaggttataagaaaggtgcagaagtcattttaaactatggacgactccgaggaacattgagtgctttgctctcctggtgtcaccttcataataataattcaactttgatcaataaaataaacaatcttctggatgcagttggccagtgtgaagagtatgtgctcaaacatctgaaatcaatcactccaccgtcccatgttgtagatttattggactccattgaggatatggacctttgtcatgtagttccagctgagaaaaagattgatgaagctaaagatgaaagactctgtgaaaataatgctgagtttaacaaaaactgtagcaagagccatagtgggatagattgttcatatgtagaatgttgtagaacacaggagcatgcacattcagaaaacccaagccccacatggattttggaacagacagccagtttagttaaacagctgggcctatcagtagatgtattacaacacctcaaacaactataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 30
- esterase D/formylglutathione hydrolase
- chromosome 7 open reading frame 20
- torsin family 1, member A (torsin A)

Buy C7orf36-chromosome 7 open reading frame 36 Gene now

Add to cart