ESD-esterase D/formylglutathione hydrolase Gene View larger

ESD-esterase D/formylglutathione hydrolase Gene

PTXBC001169

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ESD-esterase D/formylglutathione hydrolase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ESD-esterase D/formylglutathione hydrolase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001169
Product type: DNA & cDNA
Ncbi symbol: ESD
Origin species: Human
Product name: ESD-esterase D/formylglutathione hydrolase Gene
Size: 2ug
Accessions: BC001169
Gene id: 2098
Gene description: esterase D/formylglutathione hydrolase
Synonyms: FGH; S-formylglutathione hydrolase; esterase 10; esterase D/formylglutathione hydrolase; methylumbelliferyl-acetate deacetylase; testicular tissue protein Li 66; esterase D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcattgaagcagatttccagcaacaagtgctttgggggattgcagaaagtttttgaacatgacagtgttgaactaaactgcaaaatgaaatttgctgtctacttaccaccaaaggcagaaacaggaaagtgccctgcactgtattggctctcaggtttaacttgcacagagcaaaattttatatcaaaatctggttatcatcagtctgcttcagaacatggtcttgttgtcattgctccagataccagccctcgtggctgcaatattaaaggtgaagatgagagctgggactttggcactggtgctggattttatgttgatgccactgaagatccttggaaaaccaactacagaatgtactcttatgtcacagaggagcttccccaactcataaatgccaattttccagtggatccccaaaggatgtctatttttggccactccatgggaggtcatggagctctgatctgtgctttgaaaaatcctggaaaatacaaatctgtgtcagcatttgctccaatttgcaaccctgtactctgtccctggggcaaaaaagcctttagtggatatttgggaacagatcaaagtaaatggaaggcttatgatgctacccaccttgtgaaatcctatccaggatctcagctggacatactaattgatcaagggaaagatgaccagtttcttttagatggacagttactccctgataacttcatagctgcctgtacagaaaagaaaatccccgttgtttttcgattgcaagaggattatgatcatagctactacttcattgcaacctttattactgaccacatcagacatcatgctaaatacctgaatgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 20
- torsin family 1, member A (torsin A)
- mitogen-activated protein kinase 12
- solute carrier family 43, member 3

Buy ESD-esterase D/formylglutathione hydrolase Gene now

Add to cart