Login to display prices
Login to display prices
ESD-esterase D/formylglutathione hydrolase Gene View larger

ESD-esterase D/formylglutathione hydrolase Gene

PTXBC001169

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ESD-esterase D/formylglutathione hydrolase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ESD-esterase D/formylglutathione hydrolase Gene

Proteogenix catalog: PTXBC001169
Ncbi symbol: ESD
Product name: ESD-esterase D/formylglutathione hydrolase Gene
Size: 2ug
Accessions: BC001169
Gene id: 2098
Gene description: esterase D/formylglutathione hydrolase
Synonyms: FGH; S-formylglutathione hydrolase; esterase 10; esterase D/formylglutathione hydrolase; methylumbelliferyl-acetate deacetylase; testicular tissue protein Li 66; esterase D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcattgaagcagatttccagcaacaagtgctttgggggattgcagaaagtttttgaacatgacagtgttgaactaaactgcaaaatgaaatttgctgtctacttaccaccaaaggcagaaacaggaaagtgccctgcactgtattggctctcaggtttaacttgcacagagcaaaattttatatcaaaatctggttatcatcagtctgcttcagaacatggtcttgttgtcattgctccagataccagccctcgtggctgcaatattaaaggtgaagatgagagctgggactttggcactggtgctggattttatgttgatgccactgaagatccttggaaaaccaactacagaatgtactcttatgtcacagaggagcttccccaactcataaatgccaattttccagtggatccccaaaggatgtctatttttggccactccatgggaggtcatggagctctgatctgtgctttgaaaaatcctggaaaatacaaatctgtgtcagcatttgctccaatttgcaaccctgtactctgtccctggggcaaaaaagcctttagtggatatttgggaacagatcaaagtaaatggaaggcttatgatgctacccaccttgtgaaatcctatccaggatctcagctggacatactaattgatcaagggaaagatgaccagtttcttttagatggacagttactccctgataacttcatagctgcctgtacagaaaagaaaatccccgttgtttttcgattgcaagaggattatgatcatagctactacttcattgcaacctttattactgaccacatcagacatcatgctaaatacctgaatgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: