MAPK12-mitogen-activated protein kinase 12 Gene View larger

MAPK12-mitogen-activated protein kinase 12 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK12-mitogen-activated protein kinase 12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK12-mitogen-activated protein kinase 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015741
Product type: DNA & cDNA
Ncbi symbol: MAPK12
Origin species: Human
Product name: MAPK12-mitogen-activated protein kinase 12 Gene
Size: 2ug
Accessions: BC015741
Gene id: 6300
Gene description: mitogen-activated protein kinase 12
Synonyms: ERK-6; ERK3; ERK6; MAPK 12; P38GAMMA; PRKM12; SAPK-3; SAPK3; mitogen-activated protein kinase 12; MAP kinase 12; MAP kinase p38 gamma; extracellular signal-regulated kinase 6; mitogen-activated protein kinase 3; mitogen-activated protein kinase p38 gamma; stress-activated protein kinase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctctccgccgcccgcccgcagtggcttttaccgccaggaggtgaccaagacggcctgggaggtgcgcgccgtgtaccgggacctgcagcccgtgggctcgggcgcctacggcgcggtgtgctcggccgtggacggccgcaccggcgctaaggtggccatcaagaagctgtatcggcccttccagtccgagctgttcgccaagcgcgcctaccgcgagctgcgcctgctcaagcacatgcgccacgagaacgtgatcgggctgctggacgtattcactcctgatgagaccctggatgacttcacggacttttacctggtgatgccgttcatgggcaccgacctgggcaagctcatgaaacatgagaagctaggcgaggaccggatccagttcctcgtgtaccagatgctgaaggggctgaggtatatccacgctgccggcatcatccacagagacctgaagcccggcaacctggctgtgaacgaagactgtgagctgaagatcctggacttcggcctggccaggcaggcagacagtgagatgactgggtacgtggtgacccggtggtaccgggctcccgaggtcatcttgaattggatgcgctacacgcagacggtggacatctggtccgtgggctgcatcatggcggagatgatcacaggcaagacgctgttcaagggcagcgaccacctggaccagctgaaggagatcatgaaggtgacggggacgcctccggctgagtttgtgcagcggctgcagagcgatgaggccaagaactacatgaagggcctccccgaattggagaagaaggattttgcctctatcctgaccaatgcaagccctctggctgtgaacctcctggagaagatgctggtgctggacgcggagcagcgggtgacggcaggcgaggcgctggcccatccctacttcgagtccctgcacgacacggaagatgagccccaggtccagaagtatgatgactcctttgacgacgttgaccgcacactggatgaatggaagcgtgttacttacaaagaggtgctcagcttcaagcctccccggcagctgggggccagggtctccaaggagacgcctctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 43, member 3
- solute carrier family 43, member 1
- chromosome 18 open reading frame 8
- Usher syndrome 1C binding protein 1

Buy MAPK12-mitogen-activated protein kinase 12 Gene now

Add to cart