Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MRPS26-mitochondrial ribosomal protein S26 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS26-mitochondrial ribosomal protein S26 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013018 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS26 |
| Origin species: | Human |
| Product name: | MRPS26-mitochondrial ribosomal protein S26 Gene |
| Size: | 2ug |
| Accessions: | BC013018 |
| Gene id: | 64949 |
| Gene description: | mitochondrial ribosomal protein S26 |
| Synonyms: | C20orf193; GI008; MRP-S13; MRP-S26; MRPS13; NY-BR-87; RPMS13; dJ534B8.3; 28S ribosomal protein S26, mitochondrial; 28S ribosomal protein S13, mitochondrial; S13mt; S26mt; serologically defined breast cancer antigen NY-BR-87; mitochondrial ribosomal protein S26 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctacgcgcgctgagccgcctgggcgcggggaccccgtgcaggccccgggcccctctggtgctgccagcgcgcggccgcaagacccgccacgacccgctggccaaatccaagatcgagcgagtgaacatgccgcccgcggtggaccctgcggagttcttcgtgctgatggagcgttaccagcactaccgccagaccgtgcgcgccctcaggatggagttcgtgtccgaggtgcagaggaaggtgcacgaggcccgagccggggttctggcggagcgcaaggccctgaaggacgccgccgagcaccgcgagctgatggcctggaaccaggcggagaaccggcggctgcacgagctgcggatagcgaggctgcggcaggaggagcgggagcaggagcagcggcaggcgttggagcaggcccgcaaggccgaagaggtgcaggcctgggcgcagcgcaaggagcgggaagtgctgcagctgcaggaagaggtgaaaaacttcatcacccgagagaacctggaggcacgggtggaagcagcattggactcccggaagaactacaactgggccatcaccagagaggggctggtggtcaggccacaacgcagggactcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - syntaxin binding protein 6 (amisyn) - mitochondrial ribosomal protein L48 - chorionic somatomammotropin hormone 2 - mitochondrial ribosomal protein S34 |