MRPS26-mitochondrial ribosomal protein S26 Gene View larger

MRPS26-mitochondrial ribosomal protein S26 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS26-mitochondrial ribosomal protein S26 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS26-mitochondrial ribosomal protein S26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013018
Product type: DNA & cDNA
Ncbi symbol: MRPS26
Origin species: Human
Product name: MRPS26-mitochondrial ribosomal protein S26 Gene
Size: 2ug
Accessions: BC013018
Gene id: 64949
Gene description: mitochondrial ribosomal protein S26
Synonyms: C20orf193; GI008; MRP-S13; MRP-S26; MRPS13; NY-BR-87; RPMS13; dJ534B8.3; 28S ribosomal protein S26, mitochondrial; 28S ribosomal protein S13, mitochondrial; S13mt; S26mt; serologically defined breast cancer antigen NY-BR-87; mitochondrial ribosomal protein S26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctacgcgcgctgagccgcctgggcgcggggaccccgtgcaggccccgggcccctctggtgctgccagcgcgcggccgcaagacccgccacgacccgctggccaaatccaagatcgagcgagtgaacatgccgcccgcggtggaccctgcggagttcttcgtgctgatggagcgttaccagcactaccgccagaccgtgcgcgccctcaggatggagttcgtgtccgaggtgcagaggaaggtgcacgaggcccgagccggggttctggcggagcgcaaggccctgaaggacgccgccgagcaccgcgagctgatggcctggaaccaggcggagaaccggcggctgcacgagctgcggatagcgaggctgcggcaggaggagcgggagcaggagcagcggcaggcgttggagcaggcccgcaaggccgaagaggtgcaggcctgggcgcagcgcaaggagcgggaagtgctgcagctgcaggaagaggtgaaaaacttcatcacccgagagaacctggaggcacgggtggaagcagcattggactcccggaagaactacaactgggccatcaccagagaggggctggtggtcaggccacaacgcagggactcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - syntaxin binding protein 6 (amisyn)
- mitochondrial ribosomal protein L48
- chorionic somatomammotropin hormone 2
- mitochondrial ribosomal protein S34

Buy MRPS26-mitochondrial ribosomal protein S26 Gene now

Add to cart