STXBP6-syntaxin binding protein 6 (amisyn) Gene View larger

STXBP6-syntaxin binding protein 6 (amisyn) Gene

PTXBC009499

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STXBP6-syntaxin binding protein 6 (amisyn) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STXBP6-syntaxin binding protein 6 (amisyn) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009499
Product type: DNA & cDNA
Ncbi symbol: STXBP6
Origin species: Human
Product name: STXBP6-syntaxin binding protein 6 (amisyn) Gene
Size: 2ug
Accessions: BC009499
Gene id: 29091
Gene description: syntaxin binding protein 6 (amisyn)
Synonyms: HSPC156; amisyn; syntaxin-binding protein 6; syntaxin binding protein 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgccaaatctgctatcagcaaggaaatttttgcacctcttgatgaaaggatgctgggagctgtccaagtcaagaggaggacaaagaaaaagattcctttcttggcaactggaggtcaaggcgaatatttaacttatatctgcctgtcagtgacaaacaagaaacccacacaggcgtccatcacaaaggtcaaacagtttgaaggctccacatcatttgttcggagatcacagtggatgctcgagcagcttcgccaggttaatggtatcgatcctaatggggattcggcagagtttgatttgttgtttgaaaatgcttttgaccagtgggtagccagcacagcgtcagaaaaatgcaccttcttccagatcctccaccatacctgccagaggtacctcacggacaggaagccagagtttattaactgccaatccaaaattatgggaggaaacagcatcctccattcagctgctgacagcgtgaccagcgcagtgcagaaggcaagccaggccttgaatgagcgtggagagcgattaggccgagcagaggagaagacagaagacctgaagaacagcgcccagcagtttgcagaaactgcgcacaagcttgccatgaagcacaaatgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L48
- chorionic somatomammotropin hormone 2
- mitochondrial ribosomal protein S34
- epididymal sperm binding protein 1

Buy STXBP6-syntaxin binding protein 6 (amisyn) Gene now

Add to cart