MRPL12-mitochondrial ribosomal protein L12 Gene View larger

MRPL12-mitochondrial ribosomal protein L12 Gene

PTXBC002344

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL12-mitochondrial ribosomal protein L12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL12-mitochondrial ribosomal protein L12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002344
Product type: DNA & cDNA
Ncbi symbol: MRPL12
Origin species: Human
Product name: MRPL12-mitochondrial ribosomal protein L12 Gene
Size: 2ug
Accessions: BC002344
Gene id: 6182
Gene description: mitochondrial ribosomal protein L12
Synonyms: 5c5-2; L12mt; MRP-L31/34; MRPL7; MRPL7/L12; RPML12; 39S ribosomal protein L12, mitochondrial; MRP-L12; mitochondrial ribosomal protein L12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgccggcggccgctcgccccctgtgggggccttgccttgggcttcgggccgctgcgttccgccttgccaggcgacaggtgccatgtgtctgtgccgtgcgacatatgaggagcagcggccatcagaggtgtgaggccctcgctggtgcacccctggataacgcccccaaggagtacccccccaagatacagcagctggtccaggacatcgccagcctcactctcttggaaatctcagacctcaacgagctcctgaagaaaacgttgaagatccaggatgtcgggcttgtgccgatgggtggtgtgatgtctggggctgtccctgctgcagcagcccaggaggcggtggaagaagatatccccatagcgaaagaacggacacatttcaccgtccgcctgaccgaggcgaagcccgtggacaaagtgaagctgatcaaggaaatcaagaactacatccaaggcatcaacctcgtccaggcaaagaagctggtggagtccctgccccaggaaatcaaagccaatgtcgccaaagctgaggcggagaagatcaaggcggccctggaggcggtgggcggcaccgtggttctggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 50
- chromosome 4 open reading frame 43
- mitochondrial ribosomal protein S26
- syntaxin binding protein 6 (amisyn)

Buy MRPL12-mitochondrial ribosomal protein L12 Gene now

Add to cart