TOR1A-torsin family 1, member A (torsin A) Gene View larger

TOR1A-torsin family 1, member A (torsin A) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TOR1A-torsin family 1, member A (torsin A) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TOR1A-torsin family 1, member A (torsin A) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014484
Product type: DNA & cDNA
Ncbi symbol: TOR1A
Origin species: Human
Product name: TOR1A-torsin family 1, member A (torsin A) Gene
Size: 2ug
Accessions: BC014484
Gene id: 1861
Gene description: torsin family 1, member A (torsin A)
Synonyms: DQ2; DYT1; torsin-1A; dystonia 1 protein; dystonia 1, torsion (autosomal dominant; torsin A); torsin A; torsin ATPase 1; torsin ATPase-1A; torsin family 1 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgggccgggccgtgctgggcctgctgctgctggcgccgtccgtggtgcaggcggtggagcccatcagcctgggactggccctggccggcgtcctcaccggctacatctacccgcgtctctactgcctcttcgccgagtgctgcgggcagaagcggagccttagccgggaggcactgcagaaggatctggacgacaacctctttggacagcatcttgcaaagaaaatcatcttaaatgccgtgtttggtttcataaacaacccaaagcccaagaaacctctcacgctctccctgcacgggtggacaggcaccggcaaaaatttcgtcagcaagatcatcgcagagaatatttacgagggtggtctgaacagtgactatgtccacctgtttgtggccacattgcactttccacatgcttcaaacatcaccttgtacaaggcaaggatggaagtttggaatcccttcctggatgtcatcgggtttggggtctctttgttgtgggatgagatttgggagttctatgttgaaatgagtgagcccggaaaacggttcatgtctcagttccccttggaaaggtgtagaagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L12
- chromosome 1 open reading frame 50
- chromosome 4 open reading frame 43
- mitochondrial ribosomal protein S26

Buy TOR1A-torsin family 1, member A (torsin A) Gene now

Add to cart