Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TOR1A-torsin family 1, member A (torsin A) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TOR1A-torsin family 1, member A (torsin A) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014484 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TOR1A |
| Origin species: | Human |
| Product name: | TOR1A-torsin family 1, member A (torsin A) Gene |
| Size: | 2ug |
| Accessions: | BC014484 |
| Gene id: | 1861 |
| Gene description: | torsin family 1, member A (torsin A) |
| Synonyms: | DQ2; DYT1; torsin-1A; dystonia 1 protein; dystonia 1, torsion (autosomal dominant; torsin A); torsin A; torsin ATPase 1; torsin ATPase-1A; torsin family 1 member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctgggccgggccgtgctgggcctgctgctgctggcgccgtccgtggtgcaggcggtggagcccatcagcctgggactggccctggccggcgtcctcaccggctacatctacccgcgtctctactgcctcttcgccgagtgctgcgggcagaagcggagccttagccgggaggcactgcagaaggatctggacgacaacctctttggacagcatcttgcaaagaaaatcatcttaaatgccgtgtttggtttcataaacaacccaaagcccaagaaacctctcacgctctccctgcacgggtggacaggcaccggcaaaaatttcgtcagcaagatcatcgcagagaatatttacgagggtggtctgaacagtgactatgtccacctgtttgtggccacattgcactttccacatgcttcaaacatcaccttgtacaaggcaaggatggaagtttggaatcccttcctggatgtcatcgggtttggggtctctttgttgtgggatgagatttgggagttctatgttgaaatgagtgagcccggaaaacggttcatgtctcagttccccttggaaaggtgtagaagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein L12 - chromosome 1 open reading frame 50 - chromosome 4 open reading frame 43 - mitochondrial ribosomal protein S26 |