BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene View larger

BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene

PTXBC021989

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021989
Product type: DNA & cDNA
Ncbi symbol: BNIP3
Origin species: Human
Product name: BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene
Size: 2ug
Accessions: BC021989
Gene id: 664
Gene description: BCL2/adenovirus E1B 19kDa interacting protein 3
Synonyms: NIP3; BCL2/adenovirus E1B 19 kDa protein-interacting protein 3; BCL2/adenovirus E1B 19kDa interacting protein 3; BCL2 interacting protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcagaacggagcgcccgggatgcaggaggagagcctgcagggctcctgggtagaactgcacttcagcaataatgggaacgggggcagcgttccagcctcggtttctatttataatggagacatggaaaaaatactgctggacgcacagcatgagtctggacggagtagctccaagagctctcactgtgacagcccacctcgctcgcagacaccacaagataccaacagagcttctgaaacagatacccatagcattggagagaaaaacagctcacagtctgaggaagatgatattgaaagaaggaaagaagttgaaagcatcttgaagaaaaactcagattggatatgggattggtcaagtcggccggaaaatattccccccaaggagttcctctttaaacacccgaagcgcacggccaccctcagcatgaggaacacgagcgtcatgaagaaagggggcatattctctgcagaatttctgaaagttttccttccatctctgctgctctctcatttgctggccatcggattggggatctatattggaaggcgtctgacaacctccaccagcaccttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetyltransferase 14 (GCN5-related, putative)
- nuclear receptor subfamily 1, group I, member 2
- family with sequence similarity 151, member A
- v-raf murine sarcoma 3611 viral oncogene homolog

Buy BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene now

Add to cart