Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021989 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BNIP3 |
| Origin species: | Human |
| Product name: | BNIP3-BCL2/adenovirus E1B 19kDa interacting protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC021989 |
| Gene id: | 664 |
| Gene description: | BCL2/adenovirus E1B 19kDa interacting protein 3 |
| Synonyms: | NIP3; BCL2/adenovirus E1B 19 kDa protein-interacting protein 3; BCL2/adenovirus E1B 19kDa interacting protein 3; BCL2 interacting protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgcagaacggagcgcccgggatgcaggaggagagcctgcagggctcctgggtagaactgcacttcagcaataatgggaacgggggcagcgttccagcctcggtttctatttataatggagacatggaaaaaatactgctggacgcacagcatgagtctggacggagtagctccaagagctctcactgtgacagcccacctcgctcgcagacaccacaagataccaacagagcttctgaaacagatacccatagcattggagagaaaaacagctcacagtctgaggaagatgatattgaaagaaggaaagaagttgaaagcatcttgaagaaaaactcagattggatatgggattggtcaagtcggccggaaaatattccccccaaggagttcctctttaaacacccgaagcgcacggccaccctcagcatgaggaacacgagcgtcatgaagaaagggggcatattctctgcagaatttctgaaagttttccttccatctctgctgctctctcatttgctggccatcggattggggatctatattggaaggcgtctgacaacctccaccagcaccttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acetyltransferase 14 (GCN5-related, putative) - nuclear receptor subfamily 1, group I, member 2 - family with sequence similarity 151, member A - v-raf murine sarcoma 3611 viral oncogene homolog |