NR1I2-nuclear receptor subfamily 1, group I, member 2 Gene View larger

NR1I2-nuclear receptor subfamily 1, group I, member 2 Gene

PTXBC017304

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NR1I2-nuclear receptor subfamily 1, group I, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NR1I2-nuclear receptor subfamily 1, group I, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017304
Product type: DNA & cDNA
Ncbi symbol: NR1I2
Origin species: Human
Product name: NR1I2-nuclear receptor subfamily 1, group I, member 2 Gene
Size: 2ug
Accessions: BC017304
Gene id: 8856
Gene description: nuclear receptor subfamily 1, group I, member 2
Synonyms: BXR; ONR1; PAR; PAR1; PAR2; PARq; PRR; PXR; SAR; SXR; nuclear receptor subfamily 1 group I member 2; orphan nuclear receptor PAR1; orphan nuclear receptor PXR; pregnane X nuclear receptor variant 2; pregnane X receptor; steroid and xenobiotic receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacatgtgaaggatgcaagggctttttcaggagggccatgaaacgcaacgcccggctgaggtgccccttccggaagggcgcctgcgagatcacccggaagacccggcgacagtgccaggcctgccgcctgcgcaagtgcctggagagcggcatgaagaaggagatgatcatgtccgacgaggccgtggaggagaggcgggccttgatcaagcggaagaaaagtgaacggacagggactcagccactgggagtgcaggggctgacagaggagcagcggatgatgatcagggagctgatggacgctcagatgaaaacctttgacactaccttctcccatttcaagaatttccggccaggggtgcttagcagtggctgcgagttgccagagtctctgcaggccccatcgagggaagaagctgccaagtggagccaggtccggaaagatctgtgctctttgaaggtctctctgcagctgcggggggaggatggcagtgtctggaactacaaacccccagccgacagtggcgggaaagagatcttctccctgctgccccacatggctgacatgtcaacctacatgttcaaaggcatcatcagctttgccaaagtcatctcctacttcagggacttgcccatcgaggaccagatctccctgctgaagggggccgctttcgagctgtgtcaactgagattcaacacagtgttcaacgcggagactggaacctgggagtgtggccggctgtcctactgcttggaagacactgcaggtggcttccagcaacttctactggagcccatgctgaaattccactacatgctgaagaagctgcagctgcatgaggaggagtatgtgctgatgcaggccatctccctcttctccccagaccgcccaggtgtgctgcagcaccgcgtggtggaccagctgcaggagcaattcgccattactctgaagtcctacattgaatgcaatcggccccagcctgctcataggttcttgttcctgaagatcatggctatgctcaccgagctccgcagcatcaatgctcagcacacccagcggctgctgcgcatccaggacatacacccctttgctacgcccctcatgcaggagttgttcggcatcacaggtagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 151, member A
- v-raf murine sarcoma 3611 viral oncogene homolog
- ATG7 autophagy related 7 homolog (S. cerevisiae)
- transforming growth factor, beta-induced, 68kDa

Buy NR1I2-nuclear receptor subfamily 1, group I, member 2 Gene now

Add to cart