Login to display prices
Login to display prices
ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene View larger

ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene

PTXBC002466

New product

Data sheet of ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC002466
Product type: DNA & cDNA
Ncbi symbol: ARAF
Origin species: Human
Product name: ARAF-v-raf murine sarcoma 3611 viral oncogene homolog Gene
Size: 2ug
Accessions: BC002466
Gene id: 369
Gene description: v-raf murine sarcoma 3611 viral oncogene homolog
Synonyms: A-RAF; ARAF1; PKS2; RAFA1; serine/threonine-protein kinase A-Raf; A-Raf proto-oncogene serine/threonine-protein kinase; Oncogene ARAF1; Ras-binding protein DA-Raf; proto-oncogene A-Raf-1; proto-oncogene Pks; v-raf murine sarcoma 3611 viral oncogene homolog 1; v-raf murine sarcoma 3611 viral oncogene-like protein; A-Raf proto-oncogene, serine/threonine kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccaccacggggcccccctgccaatggggccgagccatcccgggcagtgggcaccgtcaaagtatacctgcccaacaagcaacgcacggtggtgactgtccgggatggcatgagtgtctacgactctctagacaaggccctgaaggtgcggggtctaaatcaggactgctgtgtggtctaccgactcatcaagggacgaaagacggtcactgcctgggacacagccattgctcccctggatggcgaggagctcattgtcgaggtccttgaagatgtcccgctgaccatgcacaattttgtacggaagaccttcttcagcctggcgttctgtgacttctgccttaagtttctgttccatggcttccgttgccaaacctgtggctacaagttccaccagcattgttcctccaaggtccccacagtctgtgttgacatgagtaccaaccgccaacagttctaccacagtgtccaggatttgtccggaggctccagacagcatgaggctccctcgaaccgccccctgaatgagttgctaaccccccagggtcccagcccccgcacccagcactgtgacccggagcacttccccttccctgccccagccaatgcccccctacagcgcatccgctccacgtccactcccaacgtccatatggtcagcaccacggcccccatggactccaacctcatccagctcactggccagagtttcagcactgatgctgccggtagtagaggaggtagtgatggaaccccccgggggagccccagcccagccagcgtgtcctcggggaggaagtccccacattccaagtcaccagcagagcagcgcgagcggaagtccttggccgatgacaagaagaaagtgaagaacctggggtaccgggactcaggctattactgggaggtaccacccagtgaggtgcagctgctgaagaggatcgggacgggctcgtttggcaccgtgtttcgagggcggtggcatggcgatgtggccgtgaaggtgctcaaggtgtcccagcccacagctgagcaggcccaggctttcaagaatgagatgcaggtgctcaggaagacgcgacatgtcaacatcttgctgtttatgggcttcatgacccggccgggatttgccatcatcacacagtggtgtgagggctccagcctctaccatcacctgcatgtggccgacacacgcttcgacatggtccagctcatcgacgtggcccggcagactgcccagggcatggactacctccatgccaagaacatcatccaccgagatctcaagtctaacaacatcttcctacatgaggggctcacggtgaagatcggtgactttggcttggccacagtgaagactcgatggagcggggcccagcccttggagcagccctcaggatctgtgctgtggatggcagctgaggtgatccgtatgcaggacccgaacccctacagcttccagtcagacgtctatgcctacggggttgtgctctacgagcttatgactggctcactgccttacagccacattggctgccgtgaccagattatctttatggtgggccgtggctatctgtccccggacctcagcaaaatctccagcaactgccccaaggccatgcggcgcctgctgtctgactgcctcaagttccagcgggaggagcggcccctcttcccccagatcctggccacaattgagctgctgcaacggtcactccccaagattgagcggagtgcctcggaaccctccttgcaccgcacccaggccgatgagttgcctgcctgcctactcagcgcagcccgccttgtgccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATG7 autophagy related 7 homolog (S. cerevisiae)
- transforming growth factor, beta-induced, 68kDa
- echinoderm microtubule associated protein like 1
- 3-hydroxy-3-methylglutaryl-Coenzyme A reductase