FAM151A-family with sequence similarity 151, member A Gene View larger

FAM151A-family with sequence similarity 151, member A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM151A-family with sequence similarity 151, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM151A-family with sequence similarity 151, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015993
Product type: DNA & cDNA
Ncbi symbol: FAM151A
Origin species: Human
Product name: FAM151A-family with sequence similarity 151, member A Gene
Size: 2ug
Accessions: BC015993
Gene id: 338094
Gene description: family with sequence similarity 151, member A
Synonyms: protein FAM151A; C1orf179; hyporthetical protein MGC27169; family with sequence similarity 151 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctgcagggagcagttatcaaagaatcaggtcaagtgggtgtttgccggcattacctgtgtgtctgtggtggtcattgccgcaatagtccttgccatcaccctgcggcggccaggctgtgagctggaggcctgcagccctgatgccgacatgctggactacctgctgagcctgggccagatcagccggcgagatgccttggaggtcacctggtaccacgcagccaacagcaagaaagccatgacagctgccctgaacagcaacatcacagtcctggaggctgacgtcaatgtagaagggctcggcacagccaatgagacaggagttcccatcatggcacacccccccactatctacagtgacaacacactggagcagtggctggacgctgtgctgggctcttcccaaaagggcatcaaactggacttcaagaacatcaaggcagtgggcccctccctggacctcctgcggcagctgacagaggaaggcaaagtccggcggcccatatggatcaacgctgacatcttaaagggccccaacatgctcatctcaactgaggtcaatgccacacagttcctggccctggtccaggagaagtatcccaaggctaccctatctccaggctggaccaccttctacatgtccacgtccccaaacaggacgtacacccaagccatggtggagaagatgcacgagctggtgggaggagtgccccagagggtcaccttccctgtacggtcttccatggtgcgggctgcctggccccacttcagctggctgctgagccaatctgagaggtacagcctgacgctgtggcaggctgcctcggaccccatgtcggtggaagatctgctctacgtccgggataacactgctgtccaccaagtctactatgacatctttgagcctctcctgctcacagatatgctagagttgtgccaggggctctggcaacctgtgtccttccagatgcaggccatgctgctgggccacagcacagctggagccataggcaggctgctggcatcctccccccgggccaccgtcacagtggagcacaacccagctgggggcgactatgcctctgtgaggacagcattgctggcagctagggctgtggacaggacccgagtctactacaggctaccccagggctaccacaaggacttgctggctcatgttggtagaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - v-raf murine sarcoma 3611 viral oncogene homolog
- ATG7 autophagy related 7 homolog (S. cerevisiae)
- transforming growth factor, beta-induced, 68kDa
- echinoderm microtubule associated protein like 1

Buy FAM151A-family with sequence similarity 151, member A Gene now

Add to cart