NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene View larger

NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019079
Product type: DNA & cDNA
Ncbi symbol: NAT14
Origin species: Human
Product name: NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene
Size: 2ug
Accessions: BC019079
Gene id: 57106
Gene description: N-acetyltransferase 14 (GCN5-related, putative)
Synonyms: KLP1; N-acetyltransferase 14; K562 cell-derived leucine-zipper-like protein 1; K562 cells-derived leucine-zipper-like protein 1; N-acetyltransferase 14 (GCN5-related, putative); N-acetyltransferase 14 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccccagccacctgtcagtgcgggagatgagggaagatgagaagcccctggtgctggagatgctgaaggccggcgtgaaggacacggaaaaccgcgtggccctccatgccttgacacggccgccggccctgctcctcctggcggcggccagcagcggcctgcgctttgtcctggcttccttcgccctggccctcctcctgccggtgttcctggctgtggccgccgtgaagctgggcctgcgggcccgatggggctcgctgcctccgccgggtggcctggggggcccctgggtggccgtgcggggctccggtgacgtgtgtggggtcctggctctggcccctggcacaaatgcaggggacggggcccgggtcacccgcctgtctgtctctcgctggcaccgccgccggggcgtgggcaggaggctgctggccttcgcggaggcccgggctcgggcctgggctgggggcatgggggagccccgggcccggctcgtggtccccgtggctgtggccgcctggggggtgggagggatgctggagggctgtggctaccaggccgaggggggctggggctgcctgggctacacgctggtgagggaattcagcaaagacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear receptor subfamily 1, group I, member 2
- family with sequence similarity 151, member A
- v-raf murine sarcoma 3611 viral oncogene homolog
- ATG7 autophagy related 7 homolog (S. cerevisiae)

Buy NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene now

Add to cart