Login to display prices
Login to display prices
NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene View larger

NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene

PTXBC019079

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene

Proteogenix catalog: PTXBC019079
Ncbi symbol: NAT14
Product name: NAT14-N-acetyltransferase 14 (GCN5-related, putative) Gene
Size: 2ug
Accessions: BC019079
Gene id: 57106
Gene description: N-acetyltransferase 14 (GCN5-related, putative)
Synonyms: KLP1; N-acetyltransferase 14; K562 cell-derived leucine-zipper-like protein 1; K562 cells-derived leucine-zipper-like protein 1; N-acetyltransferase 14 (GCN5-related, putative); N-acetyltransferase 14 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccccagccacctgtcagtgcgggagatgagggaagatgagaagcccctggtgctggagatgctgaaggccggcgtgaaggacacggaaaaccgcgtggccctccatgccttgacacggccgccggccctgctcctcctggcggcggccagcagcggcctgcgctttgtcctggcttccttcgccctggccctcctcctgccggtgttcctggctgtggccgccgtgaagctgggcctgcgggcccgatggggctcgctgcctccgccgggtggcctggggggcccctgggtggccgtgcggggctccggtgacgtgtgtggggtcctggctctggcccctggcacaaatgcaggggacggggcccgggtcacccgcctgtctgtctctcgctggcaccgccgccggggcgtgggcaggaggctgctggccttcgcggaggcccgggctcgggcctgggctgggggcatgggggagccccgggcccggctcgtggtccccgtggctgtggccgcctggggggtgggagggatgctggagggctgtggctaccaggccgaggggggctggggctgcctgggctacacgctggtgagggaattcagcaaagacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: