Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NME6-non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene
PTXBC001808
New product
Data sheet of NME6-non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NME6-non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001808 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NME6 |
| Origin species: | Human |
| Product name: | NME6-non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene |
| Size: | 2ug |
| Accessions: | BC001808 |
| Gene id: | 10201 |
| Gene description: | non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) |
| Synonyms: | IPIA-ALPHA; NDK 6; NM23-H6; nucleoside diphosphate kinase 6; NDP kinase 6; inhibitor of p53-induced apoptosis-alpha; non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase); NME/NM23 nucleoside diphosphate kinase 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacccagaatctggggagtgagatggcctcaatcttgcgaagccctcaggctctccagctcactctagccctgatcaagcctgacgcagtcgcccatccactgattctggaggctgttcatcagcagattctaagcaacaagttcctgattgtacgaatgagagaactactgtggagaaaggaagattgccagaggttttaccgagagcatgaagggcgttttttctatcagaggctggtggagttcatggccagcgggccaatccgagcctacatccttgcccacaaggatgccatccagctctggaggacgctcatgggacccaccagagtgttccgagcacgccatgtggccccagattctatccgtgggagtttcggcctcactgacacccgcaacaccacccatggttcggactctgtggtttcagccagcagagagattgcagccttcttccctgacttcagtgaacagcgctggtatgaggaggaagagccccagttgcgctgtggccctgtgtgctatagcccagagggaggtgtccactatgtagctggaacaggaggcctaggaccagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) - eukaryotic translation initiation factor 3, subunit E interacting protein - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 |