Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ELAVL3-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) Gene
PTXBC014144
New product
Data sheet of ELAVL3-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELAVL3-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014144 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELAVL3 |
| Origin species: | Human |
| Product name: | ELAVL3-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) Gene |
| Size: | 2ug |
| Accessions: | BC014144 |
| Gene id: | 1995 |
| Gene description: | ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) |
| Synonyms: | HUC; HUCL; PLE21; ELAV-like protein 3; ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C); ELAV like neuron-specific RNA binding protein 3; Hu antigen C; hu-antigen C; paraneoplastic cerebellar degeneration-associated antigen; paraneoplastic limbic encephalitis antigen 21; ELAV like RNA binding protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcactcagatactgggggccatggagtctcaggtgggggggggcccggccggcccggccctgcccaacgggccactccttggtacaaatggagccactgacgacagcaagaccaacctcatcgtcaactacctgccccagaacatgacccaggatgagttcaagagtctcttcggcagcattggcgacatcgagtcctgcaagttggttcgggacaagatcacagggcagagccttggctacgggtttgtgaactattctgaccccaatgatgcagacaaagccatcaacaccctcaacggcctcaaattacagacgaagaccatcaaggtgtcctatgccagacccagttcagcatccatccgggatgctaacctgtacgtcagcgggctccccaagaccatgagccagaaagagatggagcagctcttctcccagtacggccgcatcatcacgtcccgcatcctggtggaccaggtcacaggtgtctctcggggtgtgggattcatccgctttgacaagaggattgaggccgaagaggctatcaaaggactgaatgggcagaagccgctgggcgcagctgagcccatcacagtcaagttcgcgaacaacccaagtcagaagacggggcaggcgctgctcacccacctctaccagtcatccgcccggcgctacgcaggccccctacaccatcagacccagcgtttccggctggacaatttgctcaacatggcctacggcgtcaagagtcccctgtcgctcatcgccaggttctcgccgatcgccatcgatggtatgagcggcctggcgggcgtgggcctgtcggggggcgcggcgggcgccggctggtgcatcttcgtgtacaacctgtcaccggaggcagacgagagcgtgctgtggcagctgttcgggccttttggggcagtcaccaacgtcaaggtcatccgtgatttcaccaccaacaagtgcaagggtttcggcttcgtgaccatgaccaactatgacgaggcggccatggccatcgccagcctgaacggctatcgcctgggcgagcgcgtgctgcaggtctccttcaagaccagcaaacagcacaaggcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 3, subunit E interacting protein - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 - transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) - granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) |