ALS2CR8-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 Gene View larger

ALS2CR8-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 Gene

PTXBC033777

New product

Data sheet of ALS2CR8-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALS2CR8-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC033777
Product type: DNA & cDNA
Ncbi symbol: ALS2CR8
Origin species: Human
Product name: ALS2CR8-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 Gene
Size: 2ug
Accessions: BC033777
Gene id: 79800
Gene description: amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8
Synonyms: ALS2CR8; NYD-SP24; calcium-responsive transcription factor; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8; amyotrophic lateral sclerosis 2 chromosomal region candidate gene 8 protein; calcium-response factor; testis development protein NYD-SP24; calcium responsive transcription factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacaatctaatgattcattaagagtcaaccataatgacggtgaagagtcaaaaaccagtgctcaagtatttgagcatctaatctgtatggactccagggattcttcctttggacaaaatgattctcctacagttttgcccatcactactcgtgaagcaaataattcactcatatcacagaatataccagggcccctgactcagacacagactctttctgcagagcaattccatctagtggaccaaaatgggcaggctattcaatatgaacttcagtcattgggggaatccaatgcacaaatgatgatcgttgccagcccaacagaaaatggacaggtacttcgtgtaattccacctacccagacaggaatggcacaagtgattatacctcaggggcaacttgtggatgtgaatagtcctcgggatgtccctgaagagaaacccagtaacagaaacttaccaactgtaagagtggatactctagcagacaataccagcaattacattcttcatcctcaaacatccttcccattgcccaaaaagtcagtgaccggaatgctggaagaaccccttctggggcctcttcagccactttcttctaatacacctatatgggcctgccgtcttaggagctgtgagaaaattggagattcataccgtggctactgtgtaagtgagactgaattagaaagtgtcctaacatttcacaagcagcaaacacagagtgtttgggggacccgtcagtctccaagcccagccaagcctgctacacgcttgatgtggaaatcccagtatgttccatatgatggaatcccatttgttaatgcagggagtagagctgtggtaatggagtgtcagtatgggccaagaagaaaaggtttccagttaaaaaaagtcagtgagcaggaaagcaggtcttgtcagctctacaaagccacttgtccagctcggatttacattaaaaaggtacagaagtttcctgaatatagagttcctacagaccccaaaattgacaagaaaattatcagaatggagcaggagaaagcttttaacatgctaaagaagaacttggtagatgctggtggtgttcttaggtggtatgtacagttacctacacagcaagctcatcagtatcatgaattagagactccctgcctcactttgtcaccttctccttttcctgtgtcttctcttgaagaagaggaaactgcagttagagatgagaattgtgcattaccctcacgtttacatcctcaagtagcacataagattcaagaattagtatcacagggaatagaacaagtgtatgcagtaaggaaacagctaagaaaatttgtggaaagggaactgttcaaacccgatgaggtacctgaaagacataatttatctttgtttccaactgtaaatgatataaaaaatcacatccatgaggtacagaaatccttgagaaatggagatacggtatataactcagagattattccagcaacgcttcaatggactacagacagtgggaatattctcaaagagaccatgacagttacatttgcagaaggaaattcaccaggagaatcaattaccaccaaagtggaaacaaatcagaccaggggttctttgtctcctgagccaacccacttgctctcctcactctcctcatttcagcccaaaatatttacacaactacagggtttgcagttacaaccaaggtacacctctcctgatgaatcaccagctgtggtatcagtaaataaccagccgtcctctagtccttcaggacttctggatacaataggaagtgctgtaatgaataataattctctactgcttggtcaaagtcatagccttcaaagagatacatgcttaacccaaaacaatagtactgcctccaccatgggtaaccttccagaaccagatcaaaatctagttgcaatggacgagctggtagaagttggagatgttgaggatacagggaatctggaaggaactgttcatcggattctgttgggagatgtgcagactattccaatacagattatagacaaccactcagctcttattgaagaaaatccagaaagtaccatttctgtgagccaagttaaacaagaacccaaagaaccagcattgtctatggaagcaaaaaaaactgtggactataagaaattatctgctacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
- granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
- ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)
- inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma

Buy ALS2CR8-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 Gene now

Add to cart