EIF3EIP-eukaryotic translation initiation factor 3, subunit E interacting protein Gene View larger

EIF3EIP-eukaryotic translation initiation factor 3, subunit E interacting protein Gene


New product

Data sheet of EIF3EIP-eukaryotic translation initiation factor 3, subunit E interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3EIP-eukaryotic translation initiation factor 3, subunit E interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001101
Product type: DNA & cDNA
Ncbi symbol: EIF3EIP
Origin species: Human
Product name: EIF3EIP-eukaryotic translation initiation factor 3, subunit E interacting protein Gene
Size: 2ug
Accessions: BC001101
Gene id: 51386
Gene description: eukaryotic translation initiation factor 3, subunit E interacting protein
Synonyms: EIF3EIP; EIF3S11; EIF3S6IP; HSPC021; HSPC025; MSTP005; eukaryotic translation initiation factor 3 subunit L; eIEF associated protein HSPC021; eukaryotic translation initiation factor 3 subunit 6-interacting protein; eukaryotic translation initiation factor 3 subunit E-interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttatcccgctgatgattatgagtctgaggcggcttatgacccctacgcttatcccagcgactatgatatgcacacaggagatccaaagcaggaccttgcttatgaacgtcagtatgaacagcaaacctatcaggtgatccctgaggtgatcaaaaacttcatccagtatttccacaaaactgtctcagatttgattgaccagaaagtgtatgagctacaggccagtcgtgtctccagtgatgtcattgaccagaaggtgtatgagatccaggacatctatgagaacagctggaccaagctgactgaaagattcttcaagaatacaccttggcccgaggctgaagccattgctccacaggttggcaatgatgctgtcttcctgattttatacaaagaattatactacaggcacatatatgccaaagtcagtgggggaccttccttggagcagaggtttgaatcctattacaactactgcaatctcttcaactacattcttaatgccgatggtcctgctccccttgaactacccaaccagtggctctgggatattatcgatgagttcatctaccagtttcagtcattcagtcagtaccgctgtaagactgccaagaagtcagaggaggagattgactttcttcgttccaatcccaaaatctggaatgttcatagtgtcctcaatgtccttcattccctggtagacaaatccaacatcaaccgacagttggaggtatacacaagcggaggtgaccctgagagtgtggctggggagtatgggcggcactccctctacaaaatgcttggttacttcagcctggtcgggcttctccgcctgcactccctgttaggagattactaccaggccatcaaggtgctggagaacatcgaactgaacaagaagagtatgtattcccgtgtgccagagtgccaggtcaccacatactattatgttgggtttgcatatttgatgatgcgtcgttaccaggatgccatccgggtcttcgccaacatcctcctctacatccagaggaccaagagcatgttccagaggaccacgtacaagtatgagatgattaacaagcagaatgagcagatgcatgcgctgctggccattgccctcacgatgtaccccatgcgtattgatgagagcattcacctccagctgcgggagaaatatggggacaagatgttgcgcatgcagaaaggtgacccacaagtctatgaagaacttttcagttactcctgccccaagttcctgtcgcctgtagtgcccaactatgataatgtgcaccccaactaccacaaagagcccttcctgcagcagctgaaggtgttttctgatgaagtacagcagcaggcccagctttcaaccatccgcagcttcctgaagctctacaccaccatgcctgtggccaagctggctggcttcctggacctcacagagcaggagttccggatccagcttcttgtcttcaaacacaagatgaagaacctcgtgtggaccagcggtatctcagccctggatggtgaatttcagtcagcctcagaggttgacttctacattgataaggacatgatccacatcgcggacaccaaggtcgccaggcgttatggggatttcttcatccgtcagatccacaaatttgaggagcttaatcgaaccctgaagaagatgggacagagaccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8
- transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
- granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
- ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)

Buy EIF3EIP-eukaryotic translation initiation factor 3, subunit E interacting protein Gene now

Add to cart