GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene View larger

GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015739
Product type: DNA & cDNA
Ncbi symbol: GZMA
Origin species: Human
Product name: GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene
Size: 2ug
Accessions: BC015739
Gene id: 3001
Gene description: granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Synonyms: CTLA3; HFSP; granzyme A; CTL tryptase; Cytotoxic T-lymphocyte-associated serine esterase-3; Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease); Hanukah factor serine protease); cytotoxic T-lymphocyte proteinase 1; fragmentin-1; granzyme 1; granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3); h factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggaactcctatagatttctggcatcctctctctcagttgtcgtttctctcctgctaattcctgaagatgtctgtgaaaaaattattggaggaaatgaagtaactcctcattcaagaccctacatggtcctacttagtcttgacagaaaaaccatctgtgctggggctttgattgcaaaagactgggtgttgactgcagctcactgtaacttgaacaaaaggtcccaggtcattcttggggctcactcaataaccagggaagagccaacaaaacagataatgcttgttaagaaagagtttccctatccatgctatgacccagccacacgcgaaggtgaccttaaacttttacagctgacggaaaaagcaaaaattaacaaatatgtgactatccttcatctacctaaaaagggggatgatgtgaaaccaggaaccatgtgccaagttgcagggtggggcaggactcacaatagtgcatcttggtccgatactctgagagaagtcaatatcaccatcatagacagaaaagtctgcaatgatcgaaatcactataattttaaccctgtgattggaatgaatatggtttgtgctggaagcctccgaggtggaagagactcgtgcaatggagattctggaagccctttgttgtgcgagggtgttttccgaggggtcacttcctttggccttgaaaataaatgcggagaccctcgtgggcctggtgtctatattcttctctcaaagaaacacctcaactggataattatgactatcaagggagcagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
- eukaryotic translation initiation factor 3, subunit E interacting protein
- amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8
- transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)

Buy GZMA-granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) Gene now

Add to cart