TRIML1-tripartite motif family-like 1 Gene View larger

TRIML1-tripartite motif family-like 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRIML1-tripartite motif family-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRIML1-tripartite motif family-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015684
Product type: DNA & cDNA
Ncbi symbol: TRIML1
Origin species: Human
Product name: TRIML1-tripartite motif family-like 1 Gene
Size: 2ug
Accessions: BC015684
Gene id: 339976
Gene description: tripartite motif family-like 1
Synonyms: RNF209; RING finger protein 209; tripartite motif family like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggagatgctaagaaaattcagcacggagataacgctggacccagccacagctaatgcctatctcgtgttgtcggaggatctgaagagtgtgaaatatgggggaagcagacagcagctacccgacaacccggaaagatttgaccagtctgcgactgtgctgggtactcagatcttcaccagtgggagacactactgggaggtggaggtgggaaacaagaccgagtgggaagtgggcatctgcaaggactctgtgagcagaaaggggaatctccccaagccacctggggacctgttctcactaataggtttaaaaatcggagatgattacagcctctgggtctcgtcacctttgaaaggtcagcacgtcagagagcctgtgtgtaaggttggtgtcttcctggactatgaatctggacatatagcattctacaacgggacggatgaatccctcatctacagcttcccgcaggcttctttccaagaggccctcaggcctatcttttccccctgcctcccaaatgaggggacaaacacagaccctctcaccatctgctcactgaacagccacgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein O-fucosyltransferase 1
- chromatin modifying protein 1B
- zinc finger, AN1-type domain 5
- chromatin modifying protein 4C

Buy TRIML1-tripartite motif family-like 1 Gene now

Add to cart