ZFAND5-zinc finger, AN1-type domain 5 Gene View larger

ZFAND5-zinc finger, AN1-type domain 5 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFAND5-zinc finger, AN1-type domain 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZFAND5-zinc finger, AN1-type domain 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011018
Product type: DNA & cDNA
Ncbi symbol: ZFAND5
Origin species: Human
Product name: ZFAND5-zinc finger, AN1-type domain 5 Gene
Size: 2ug
Accessions: BC011018
Gene id: 7763
Gene description: zinc finger, AN1-type domain 5
Synonyms: ZA20D2; ZFAND5A; ZNF216; AN1-type zinc finger protein 5; zinc finger A20 domain-containing protein 2; zinc finger protein 216; zinc finger, A20 domain containing 2; zinc finger, AN1-type domain 5; zinc finger AN1-type containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcaggagactaaccagaccccggggcccatgctgtgtagcacaggatgtggcttttatggaaatcctaggacaaatggaatgtgttcagtttgctacaaagaacatcttcagaggcagcaaaatagtggcagaatgagcccaatggggacagctagtggttccaacagtcctacctcagattctgcatctgtacagagagcagacactagcttaaacaactgtgaaggtgctgctggcagcacatctgaaaaatcaagaaatgtgcctgtggctgccttgcctgtaactcagcaaatgacagaaatgagcatttcaagagaggacaaaataactaccccgaaaacagaggtgtcagagccagttgtcactcagcccagtccatcagtttctcagcccagtacttctcagagtgaagaaaaagctcctgaattgcccaaaccaaagaaaaacagatgtttcatgtgcagaaagaaagttggtcttacagggtttgactgccgatgtggaaatttgttttgtggacttcaccgttactctgacaagcacaactgtccgtatgattacaaagcagaagctgcagcaaaaatcagaaaagagaatccagttgttgtggctgaaaaaattcagagaatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromatin modifying protein 4C
- armadillo repeat containing 10
- retinaldehyde binding protein 1
- aarF domain containing kinase 2

Buy ZFAND5-zinc finger, AN1-type domain 5 Gene now

Add to cart