Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ZFAND5-zinc finger, AN1-type domain 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZFAND5-zinc finger, AN1-type domain 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011018 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZFAND5 |
| Origin species: | Human |
| Product name: | ZFAND5-zinc finger, AN1-type domain 5 Gene |
| Size: | 2ug |
| Accessions: | BC011018 |
| Gene id: | 7763 |
| Gene description: | zinc finger, AN1-type domain 5 |
| Synonyms: | ZA20D2; ZFAND5A; ZNF216; AN1-type zinc finger protein 5; zinc finger A20 domain-containing protein 2; zinc finger protein 216; zinc finger, A20 domain containing 2; zinc finger, AN1-type domain 5; zinc finger AN1-type containing 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcaggagactaaccagaccccggggcccatgctgtgtagcacaggatgtggcttttatggaaatcctaggacaaatggaatgtgttcagtttgctacaaagaacatcttcagaggcagcaaaatagtggcagaatgagcccaatggggacagctagtggttccaacagtcctacctcagattctgcatctgtacagagagcagacactagcttaaacaactgtgaaggtgctgctggcagcacatctgaaaaatcaagaaatgtgcctgtggctgccttgcctgtaactcagcaaatgacagaaatgagcatttcaagagaggacaaaataactaccccgaaaacagaggtgtcagagccagttgtcactcagcccagtccatcagtttctcagcccagtacttctcagagtgaagaaaaagctcctgaattgcccaaaccaaagaaaaacagatgtttcatgtgcagaaagaaagttggtcttacagggtttgactgccgatgtggaaatttgttttgtggacttcaccgttactctgacaagcacaactgtccgtatgattacaaagcagaagctgcagcaaaaatcagaaaagagaatccagttgttgtggctgaaaaaattcagagaatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromatin modifying protein 4C - armadillo repeat containing 10 - retinaldehyde binding protein 1 - aarF domain containing kinase 2 |