ADCK2-aarF domain containing kinase 2 Gene View larger

ADCK2-aarF domain containing kinase 2 Gene

PTXBC014107

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADCK2-aarF domain containing kinase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ADCK2-aarF domain containing kinase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014107
Product type: DNA & cDNA
Ncbi symbol: ADCK2
Origin species: Human
Product name: ADCK2-aarF domain containing kinase 2 Gene
Size: 2ug
Accessions: BC014107
Gene id: 90956
Gene description: aarF domain containing kinase 2
Synonyms: AARF; uncharacterized aarF domain-containing protein kinase 2; aarF domain containing kinase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggcgccctggcgcgtctccgtcagggtttgcctgtcgcacctgaggtgcttcgagctcagacagggactcagcctcctgaggccctccgagtgccctcgcgatgccaggctctgctggcttctgctgggcactttgcccaaggtcgtctccctgtgcggggacgtgggtgagggggcccctgacgttctgagtcggcgaagggtccgctgcagcggggcggctggcgcggggcccgcggagagcctcccccgagcgggacctctgggcggcgtcttcctgcatctccgcctctggcttcgcgccggcgctctgttggtgaaattcttccccctcctactcctctaccccctcacctacctggctcccagcgtctccaccctctggctccacctgcttctgaaagccaccgagacctcaggcccaacctacatcaaactgggccagtgggccagcacccggcgcgatctgttttcggaggctttctgtgcccaattttccaagctgcatgtccgagtgacgccccacccgtggactcacactgagcgcttccttcggcaggcttttggggatgactgggggagcatcctctcttttgagaaccgggaacctgtgggctcaggctgcgtggcccaggtgtacaaagcatacgccaacactgccttcctggagactgacagcgtccagagacttggcagggcctcctgtctgccgcccttctcacatactggggcagtcggtgggctgagagagctctttggataccttggaaatggccggaaacctccagaaaatctcgcagaccagtcgtttctagaaaggctgctcctccctaaagctgacctggttggatcaaatgcaggggtgtctcgggctcaggtccctggccaccaacctgaggccaccaacctcatctccgtggcagtgaaagtgttgcaccctggcctgctcgctcaggtgcatatggacctgctgctgatgaagattggcagccgagtcctgggagttttgccaggcatcaagtggcttagcttgcctgagattgtggaggaatttgagaagctgatggtccaacagattgacctgcgttacgaagctcagaatctagaacacttccaggtcaacttccggaatgtgaaagccgtcaagttccccactcccaagagcctctcctatggcagctgggacgttttaaaattgggacaccaatttcaaatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin specific peptidase 48
- uridine monophosphate synthetase
- exonuclease 3'-5' domain-like 2
- immunoglobulin heavy constant mu

Buy ADCK2-aarF domain containing kinase 2 Gene now

Add to cart