Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CHMP4C-chromatin modifying protein 4C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHMP4C-chromatin modifying protein 4C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014321 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHMP4C |
| Origin species: | Human |
| Product name: | CHMP4C-chromatin modifying protein 4C Gene |
| Size: | 2ug |
| Accessions: | BC014321 |
| Gene id: | 92421 |
| Gene description: | chromatin modifying protein 4C |
| Synonyms: | SNF7-3; Shax3; VPS32C; charged multivesicular body protein 4c; SNF7 homolog associated with Alix 3; Snf7 homologue associated with Alix 3; chromatin modifying protein 4C; chromatin-modifying protein 4c; hSnf7-3; hVps32-3; vacuolar protein sorting-associated protein 32-3; vps32-3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcaagttgggcaagttctttaaagggggcggctcttctaagagccgagccgctcccagtccccaggaggccctggtccgacttcgggagactgaggagatgctgggcaagaaacaagagtacctggaaaatcgaatccagagagaaatcgccctggccaagaagcacggcacgcagaataagcgagctgcattacaggcactaaagagaaagaagaggttcgagaaacagctcactcagattgatggcacactttctaccattgagttccagagagaagccctggagaactcacacaccaacactgaggtgttgaggaacatgggctttgcagcaaaagcgatgaaatctgttcatgaaaacatggatctgaacaaaatagatgatttgatgcaagagatcacagagcaacaggatatcgcccaagaaatctcagaagcattttctcaacgggttggctttggtgatgactttgatgaggatgagttgatggcagaacttgaagaattggaacaggaggaattaaataagaagatgacaaatatccgccttccaaatgtgccttcctcttctctcccagcacagccaaatagaaaaccaggcatgtcgtccactgcacgtcgatcccgagcagcatcttcccagagggcagaagaagaggatgatgatatcaaacaattggcagcttgggctacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - armadillo repeat containing 10 - retinaldehyde binding protein 1 - aarF domain containing kinase 2 - ubiquitin specific peptidase 48 |