Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CHMP1B-chromatin modifying protein 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHMP1B-chromatin modifying protein 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012733 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHMP1B |
| Origin species: | Human |
| Product name: | CHMP1B-chromatin modifying protein 1B Gene |
| Size: | 2ug |
| Accessions: | BC012733 |
| Gene id: | 57132 |
| Gene description: | chromatin modifying protein 1B |
| Synonyms: | C10orf2; C18-ORF2; C18orf2; CHMP1.5; Vps46-2; Vps46B; hVps46-2; charged multivesicular body protein 1b; chromatin modifying protein 1B; chromatin-modifying protein 1b; vacuolar protein sorting 46-2; vacuolar protein sorting-associated protein 46-2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctaacatggagaaacacctgttcaacctgaagttcgcggccaaagaactgagtaggagtgccaaaaaatgcgataaggaggaaaaggccgaaaaggccaaaattaaaaaggccattcagaagggcaacatggaagttgcgaggatacacgccgaaaatgccatccgccagaagaaccaggcggtgaatttcttgagaatgagtgcgcgagtcgatgcagtggctgccagggtccagacggcggtgacgatgggcaaggtgaccaagtcgatggctggtgtggttaagtcgatggatgcgacattgaagaccatgaatctggagaagatttctgctttgatggacaaattcgagcaccagtttgagactctggacgtccagacgcagcaaatggaagacacgatgagcagcacgacgacgctcaccactccccagaaccaagtggatatgctgctccaggaaatggcagatgaggcgggcctcgacctcaacatggagctgccgcagggccagaccggctccgtgggcacgagcgtggcttcggcggagcaggatgaactgtctcagagactggcccgccttcgggatcaagtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, AN1-type domain 5 - chromatin modifying protein 4C - armadillo repeat containing 10 - retinaldehyde binding protein 1 |