Login to display prices
Login to display prices
POFUT1-protein O-fucosyltransferase 1 Gene View larger

POFUT1-protein O-fucosyltransferase 1 Gene

PTXBC000582

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POFUT1-protein O-fucosyltransferase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POFUT1-protein O-fucosyltransferase 1 Gene

Proteogenix catalog: PTXBC000582
Ncbi symbol: POFUT1
Product name: POFUT1-protein O-fucosyltransferase 1 Gene
Size: 2ug
Accessions: BC000582
Gene id: 23509
Gene description: protein O-fucosyltransferase 1
Synonyms: DDD2; FUT12; O-FUT; O-Fuc-T; O-FucT-1; OFUCT1; GDP-fucose protein O-fucosyltransferase 1; o-fucosyltransferase protein; peptide-O-fucosyltransferase 1; protein O-fucosyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgccgccgcgtgggcacggccgctgagcgtgtctttcctgctgctgcttctgccgctcccggggatgcctgcgggctcctgggacccggccggttacctgctctactgcccctgcatggggcgctttgggaaccaggccgatcacttcttgggctctctggcatttgcaaagctgctaaaccgtaccttggctgtccctccttggattgagtaccagcatcacaagcctcctttcaccaacctccatgtgtcctaccagaagtacttcaagctggagcccctccaggcttaccatcgggtcatcagcttggaggatttcatggagaagctggcacccacccactggccccctgagaagcgggtggcatactgctttgaggtggcagcccagcgaagcccagataagaagacgtgccccatgaaggaaggaaacccctttggcccattctgggatcagtttcatgtgagtttcaacaagtcggagctttttacaggcatttccttcagtgcttcctacagagaacaatggagccagaggcgtgagaatcactcctgtgttaccttactcttcccaaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: