POFUT1-protein O-fucosyltransferase 1 Gene View larger

POFUT1-protein O-fucosyltransferase 1 Gene

PTXBC000582

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POFUT1-protein O-fucosyltransferase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POFUT1-protein O-fucosyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000582
Product type: DNA & cDNA
Ncbi symbol: POFUT1
Origin species: Human
Product name: POFUT1-protein O-fucosyltransferase 1 Gene
Size: 2ug
Accessions: BC000582
Gene id: 23509
Gene description: protein O-fucosyltransferase 1
Synonyms: DDD2; FUT12; O-FUT; O-Fuc-T; O-FucT-1; OFUCT1; GDP-fucose protein O-fucosyltransferase 1; o-fucosyltransferase protein; peptide-O-fucosyltransferase 1; protein O-fucosyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgccgccgcgtgggcacggccgctgagcgtgtctttcctgctgctgcttctgccgctcccggggatgcctgcgggctcctgggacccggccggttacctgctctactgcccctgcatggggcgctttgggaaccaggccgatcacttcttgggctctctggcatttgcaaagctgctaaaccgtaccttggctgtccctccttggattgagtaccagcatcacaagcctcctttcaccaacctccatgtgtcctaccagaagtacttcaagctggagcccctccaggcttaccatcgggtcatcagcttggaggatttcatggagaagctggcacccacccactggccccctgagaagcgggtggcatactgctttgaggtggcagcccagcgaagcccagataagaagacgtgccccatgaaggaaggaaacccctttggcccattctgggatcagtttcatgtgagtttcaacaagtcggagctttttacaggcatttccttcagtgcttcctacagagaacaatggagccagaggcgtgagaatcactcctgtgttaccttactcttcccaaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromatin modifying protein 1B
- zinc finger, AN1-type domain 5
- chromatin modifying protein 4C
- armadillo repeat containing 10

Buy POFUT1-protein O-fucosyltransferase 1 Gene now

Add to cart