Login to display prices
Login to display prices
BAX-BCL2-associated X protein Gene View larger

BAX-BCL2-associated X protein Gene

PTXBC014175

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAX-BCL2-associated X protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BAX-BCL2-associated X protein Gene

Proteogenix catalog: PTXBC014175
Ncbi symbol: BAX
Product name: BAX-BCL2-associated X protein Gene
Size: 2ug
Accessions: BC014175
Gene id: 581
Gene description: BCL2-associated X protein
Synonyms: apoptosis regulator BAX; BCL2L4; BCL2 associated X protein; BCL2-associated X protein omega; Baxdelta2G9; Baxdelta2G9omega; Baxdelta2omega; bcl-2-like protein 4; bcl2-L-4; BCL2 associated X, apoptosis regulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatctggaagaagatgggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: