Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BAX-BCL2-associated X protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BAX-BCL2-associated X protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014175 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BAX |
| Origin species: | Human |
| Product name: | BAX-BCL2-associated X protein Gene |
| Size: | 2ug |
| Accessions: | BC014175 |
| Gene id: | 581 |
| Gene description: | BCL2-associated X protein |
| Synonyms: | apoptosis regulator BAX; BCL2L4; BCL2 associated X protein; BCL2-associated X protein omega; Baxdelta2G9; Baxdelta2G9omega; Baxdelta2omega; bcl-2-like protein 4; bcl2-L-4; BCL2 associated X, apoptosis regulator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatctggaagaagatgggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acyl-CoA thioesterase 9 - elastase 3A, pancreatic - elastase 3B, pancreatic - ovo-like 2 (Drosophila) |