Login to display prices
Login to display prices
C1orf149-chromosome 1 open reading frame 149 Gene View larger

C1orf149-chromosome 1 open reading frame 149 Gene

PTXBC016328

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf149-chromosome 1 open reading frame 149 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf149-chromosome 1 open reading frame 149 Gene

Proteogenix catalog: PTXBC016328
Ncbi symbol: C1orf149
Product name: C1orf149-chromosome 1 open reading frame 149 Gene
Size: 2ug
Accessions: BC016328
Gene id: 64769
Gene description: chromosome 1 open reading frame 149
Synonyms: C1orf149; CENP-28; EAF6; NY-SAR-91; chromatin modification-related protein MEAF6; Esa1p-associated factor 6 homolog; centromere protein 28; protein EAF6 homolog; sarcoma antigen NY-SAR-91; MYST/Esa1 associated factor 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgatgcacaacaaggcggcgccgccgcagatcccggacacccggcgggagctggcggagctcgtgaagcggaagcaggagctggcggaaacattggcaaatttggagcgacagatctatgcttttgagggaagctacctggaagacactcagatgtatggcaatattattcgtggctgggatcggtatctgaccaaccaaaaaaactccaatagcaaaaatgatcgaaggaaccggaagtttaaggaagctgagcggctcttcagtaaatcctcggttacctcagcagctgcagtaagtgcattggcaggagttcaggaccagctcattgaaaagagggagccaggaagtgggacggaaagtgacacttctccagacttccacaatcaggaaaatgagcccagccaggaggaccctgaggatctggatggatctgtgcagggagtgaaacctcagaaggctgcttcttctacttcctcagggagtcaccacagcagccataaaaagcgaaagaataaaaaccggcacaggattgatctgaagttaaacaaaaaaccacgagctgactattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: