C11orf70-chromosome 11 open reading frame 70 Gene View larger

C11orf70-chromosome 11 open reading frame 70 Gene

PTXBC006128

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf70-chromosome 11 open reading frame 70 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf70-chromosome 11 open reading frame 70 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006128
Product type: DNA & cDNA
Ncbi symbol: C11orf70
Origin species: Human
Product name: C11orf70-chromosome 11 open reading frame 70 Gene
Size: 2ug
Accessions: BC006128
Gene id: 85016
Gene description: chromosome 11 open reading frame 70
Synonyms: uncharacterized protein C11orf70; chromosome 11 open reading frame 70
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggcagaatcaaggcgcaggcgttcggctttgaccagacctttcagtcctatcggaaggatgatttcgttatggcttttttcaaagacccaaatgttattcccaatttgaagttactttcagattcttctggacaatggatcatattaggaactgaagtgaaaaaaattgaagctataaatgttccttgcacacagctttcaatgtcattttttcatcggttatatgatgaagatattgtacgagacagtggacatattgttaaatgtttagattctttttgtgatccatttctcatttctgatgagttacgaagagttttgctagtggaagactcagaaaaatatgaaatattcagccaaccagatagagaagagttcctgttttgtcttttcaaacatctttgccttggtggagccctttgtcaatatgaggatgtgattagcccatatctggaaacaacaaagcttatctataaggatctggtgagtgttcgaaagaatcctcaaaccaagaaaatacagattacctcttctgtctttaaagtttcagcttatgattctgctggtatgtgctatccttcagcaaagaatcatgaacagacattttcttactttattgtggatcctatcaggcgtcaccttcatgttttataccactgttatggtgtgggagacatgtcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 6 open reading frame 105
- protein C receptor, endothelial (EPCR)
- B-cell receptor-associated protein 29
- partner of NOB1 homolog (S. cerevisiae)

Buy C11orf70-chromosome 11 open reading frame 70 Gene now

Add to cart