Cart 32 Product Products 6 219,13 € (empty)
-
1 x ZNF174-zin...113,40 € -
-
-
1 x TESC-tesca...113,40 € -
1 x SH3BGR-SH3...113,40 € -
1 x WBP2NL-WBP...121,50 € -
1 x HIST2H3A-h...113,40 € -
1 x MIP-3β...259,07 € -
-
-
1 x KLF15-Krup...121,50 € -
1 x ZNF215-zin...121,50 € -
1 x C18orf25-c...121,50 € -
1 x ZIK1-zinc...121,50 € -
1 x SLAMF8-SLA...121,50 € -
1 x LOC145757-...113,40 € -
-
-
-
1 x TCN2-trans...121,50 € -
1 x CCDC130-co...121,50 € -
1 x DBI-diazep...113,40 € -
1 x C19orf12-c...113,40 € -
1 x ZMAT2-zinc...113,40 € -
1 x SPRR2A-sma...113,40 € -
-
1 x C2orf49-ch...113,40 € -
1 x LZIC-leuci...113,40 € -
1 x PYHIN1-pyr...113,40 € -
1 x RBPJ-recom...121,50 € -
1 x SLC15A3-so...121,50 € -
No products
To be determined Shipping
6 219,13 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 219,13 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 219,13 €
View larger 
Data sheet of BCAP29-B-cell receptor-associated protein 29 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCAP29-B-cell receptor-associated protein 29 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008478 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCAP29 |
| Origin species: | Human |
| Product name: | BCAP29-B-cell receptor-associated protein 29 Gene |
| Size: | 2ug |
| Accessions: | BC008478 |
| Gene id: | 55973 |
| Gene description: | B-cell receptor-associated protein 29 |
| Synonyms: | B-cell receptor-associated protein 29; BCR-associated protein 29; B-cell receptor associated protein 29 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacactccaatgggctgcagtggcaacctttctttatgccgaaataggactcattttaatcttctgcctaccttttattcctcctcagagatggcagaagattttttcatttaatgtctggggtaaaattgcaactttttggaacaaggctttccttaccattatcatcctattgattgttctatttctagatgctgtgagagaagtaaggaaatattcctcagttcataccattgagaagagctccaccagcagacctgatgcctatgaacacacacagatgaaactttttaggtctcaaagaaatctttacatttctggattttccctatttttttggctagttttgagacgtctggttacgcttattactcaactggcaaaagaactgtcaaacaaaggtgtacttaaaactcaagcagaaaatactaacaaggctgccaaaaaatttatggaagaaaacgaaaaactaaaaaggattttgaaaagccatggtaaagatgaagaatgtgttttggaagcagaaaataaaaaactagtagaagaccaggagaaactgaaaactgaattaaggaagacttcagatgccctttctaaggcacaaaatgatgtgatggaaatgaagatgcagtcagagagactttcgaaagaatatgatcaactcctgaaagaacactctgaacttcaggatcgtttagaaagaggcaacaagaaaagactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - partner of NOB1 homolog (S. cerevisiae) - mitochondrial ribosomal protein S18B - solute carrier family 25, member 33 - solute carrier family 22, member 18 |