BCAP29-B-cell receptor-associated protein 29 Gene View larger

BCAP29-B-cell receptor-associated protein 29 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCAP29-B-cell receptor-associated protein 29 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BCAP29-B-cell receptor-associated protein 29 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008478
Product type: DNA & cDNA
Ncbi symbol: BCAP29
Origin species: Human
Product name: BCAP29-B-cell receptor-associated protein 29 Gene
Size: 2ug
Accessions: BC008478
Gene id: 55973
Gene description: B-cell receptor-associated protein 29
Synonyms: B-cell receptor-associated protein 29; BCR-associated protein 29; B-cell receptor associated protein 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacactccaatgggctgcagtggcaacctttctttatgccgaaataggactcattttaatcttctgcctaccttttattcctcctcagagatggcagaagattttttcatttaatgtctggggtaaaattgcaactttttggaacaaggctttccttaccattatcatcctattgattgttctatttctagatgctgtgagagaagtaaggaaatattcctcagttcataccattgagaagagctccaccagcagacctgatgcctatgaacacacacagatgaaactttttaggtctcaaagaaatctttacatttctggattttccctatttttttggctagttttgagacgtctggttacgcttattactcaactggcaaaagaactgtcaaacaaaggtgtacttaaaactcaagcagaaaatactaacaaggctgccaaaaaatttatggaagaaaacgaaaaactaaaaaggattttgaaaagccatggtaaagatgaagaatgtgttttggaagcagaaaataaaaaactagtagaagaccaggagaaactgaaaactgaattaaggaagacttcagatgccctttctaaggcacaaaatgatgtgatggaaatgaagatgcagtcagagagactttcgaaagaatatgatcaactcctgaaagaacactctgaacttcaggatcgtttagaaagaggcaacaagaaaagactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - partner of NOB1 homolog (S. cerevisiae)
- mitochondrial ribosomal protein S18B
- solute carrier family 25, member 33
- solute carrier family 22, member 18

Buy BCAP29-B-cell receptor-associated protein 29 Gene now

Add to cart