Login to display prices
Login to display prices
SLC22A18-solute carrier family 22, member 18 Gene View larger

SLC22A18-solute carrier family 22, member 18 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC22A18-solute carrier family 22, member 18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC22A18-solute carrier family 22, member 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015571
Product type: DNA & cDNA
Ncbi symbol: SLC22A18
Origin species: Human
Product name: SLC22A18-solute carrier family 22, member 18 Gene
Size: 2ug
Accessions: BC015571
Gene id: 5002
Gene description: solute carrier family 22, member 18
Synonyms: BWR1A; BWSCR1A; HET; IMPT1; ITM; ORCTL2; SLC22A1L; TSSC5; p45-BWR1A; solute carrier family 22 member 18; beckwith-Wiedemann syndrome chromosomal region 1 candidate gene A protein; efflux transporter-like protein; imprinted multi-membrane-spanning polyspecific transporter-related protein 1; organic cation transporter-like protein 2; p45 Beckwith-Wiedemann region 1A; tumor-suppressing STF cDNA 5 protein; tumor-suppressing subchromosomal transferable fragment candidate gene 5 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagggagctcgggctcccagggaccagggccagtcccccggcaggatgagcgctctaggccggtcctcggtcatcttgcttacctacgtgctggccgccacagaacttacctgcctcttcatgcagttctccatcgtgccatacctgtctcggaaactgggcctggattccattgccttcggctacctgcaaaccaccttcggggtgctgcagctgctgggcgggccggtgtttggcaggttcgcagaccagcgcggggcgcgggcggcgctcacgctctccttcctggctgccttggcgctctacctgctcctggcggccgcctccagcccggccctgcccggggtctacctgctcttcgcctcgcgcctgcccggagcgctcatgcacacgctgccagccgcccagatggtcatcacggacctgtcggcacccgaggagcggcccgcggccctgggccggctgggcctctgcttcggcgtcggagtcatcctcggctccctgctgggcgggaccctggtctccgcgtacgggattcagtgcccggccatcctggctgccctggccaccctcctgggagctgtcctcagcttcacctgcatccccgccagcaccaaaggggccaaaactgacgcccaggctccactgccaggcggcccccgggccagtgtgttcgacctgaaggccatcgcctccctgctgcggctgccagacgtcccgaggatcttcctggtgaaggtggcctccaactgccccacagggctcttcatggtcatgttctccatcatctccatggacttcttccagctggaggccgcccaagctggctacctcatgtccttcttcgggctcctccagatggtgacccagggcctggtcatcgggcagctgagcagccacttctcggaggaggtgctgctccgggccagcgtgctggtcttcatcgtggtgggcctggccatggcctggatgtccagcgtcttccacttctgcctcctggtgcccggcctggtgttcagcctctgcaccctcaacgtggtcaccgacagcatgctgatcaaggctgtctccacctcggacacagggaccatgctgggcctctgcgcctctgtacaaccactgctccgaactctgggacccacggtcggcggcctcctgtaccgcagctttggcgtccccgtcttcggccacgtgcaggttgctatcaatacccttgtcctcctggtcctctggaggaaacctatgccccagaggaaggacaaagtccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger CCCH-type containing 12A
- chromosome 1 open reading frame 116
- chromosome 17 open reading frame 80
- protein inhibitor of activated STAT, 3