Login to display prices
Login to display prices
ZC3H12A-zinc finger CCCH-type containing 12A Gene View larger

ZC3H12A-zinc finger CCCH-type containing 12A Gene


New product

Data sheet of ZC3H12A-zinc finger CCCH-type containing 12A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZC3H12A-zinc finger CCCH-type containing 12A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005001
Product type: DNA & cDNA
Ncbi symbol: ZC3H12A
Origin species: Human
Product name: ZC3H12A-zinc finger CCCH-type containing 12A Gene
Size: 2ug
Accessions: BC005001
Gene id: 80149
Gene description: zinc finger CCCH-type containing 12A
Synonyms: ribonuclease ZC3H12A; bifunctional endoribonuclease and deubiquitinase ZC3H12A; endoribonuclease ZC3H12A; MCPIP; MCPIP-1; MCPIP1; Reg1; dJ423B22.1; MCP-1 treatment-induced protein; MCP-induced protein 1; monocyte chemotactic protein-induced protein 1; regnase-1; zinc finger CCCH domain-containing protein 12A; zinc finger CCCH-type containing 12A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtggcccctgtggagagaagcctgtcctggaagccagccccaccatgagtctgtgggaatttgaggacagccacagccgtcagggcaccccaaggccgggtcaagagctggccgctgaggaggcctcggccctggaactgcagatgaaggtggacttcttccggaagctgggctattcatccacggagatccacagcgtcctgcagaagctgggcgtccaggcagacaccaacacggtgctgggtgagctggtgaaacacgggacagccaccgagcgggagcgccagacctcaccggacccctgccctcagctccctctagtcccgcggggtggtggcacccctaaggctcccaacctggagcctccactcccagaagaggaaaaggagggcagcgacctgagaccagtggtcatcgatgggagcaacgtggccatgagccatgggaacaaggaggtcttctcctgccggggcatcctgctggcagtgaactggtttctggagcggggccacacagacatcacagtgtttgtgccatcctggaggaaggagcagcctcggcccgacgtgcccatcacagaccagcacatcctgcgggaactggagaagaagaagatcctggtgttcacaccatcacgacgcgtgggtggcaagcgggtggtgtgctatgacgacagattcattgtgaagctggcctacgagtctgacgggatcgtggtttccaacgacacataccgtgacctccaaggcgagcggcaggagtggaagcgcttcatcgaggagcggctgctcatgtactccttcgtcaatgacaagtttatgccccctgatgacccactgggccggcacgggcccagcctggacaacttcctgcgtaagaagccactcactttggagcacaggaagcagccgtgtccctatggaaggaaatgcacctatgggatcaagtgccgattcttccacccagagcggccaagctgcccccagcgctctgtggcagatgagctccgtgccaatgctctcctctcaccccccagagccccaagcaaggacaaaaatggccggcggccttcaccttcatcccagtccagctctctgctaacagagagtgagcagtgcagcctggatgggaagaagctgggggcccaggcatccccagggtcccgccaagagggtctaacacagacctatgccccatcaggcaggagcctcgcacctagcgggggcagtggcagcagctttgggcccacagactggctcccacagacgctggactcactcccgtacgtctcccaggattgcctggactcgggcattggctccctggagagccagatgtcggaactttggggggttcgaggaggaggccctggtgagccgggcccaccccgagccccttacacgggctacagtccctatggatctgagctcccagccaccgcagccttctctgcctttggccgggccatgggtgctggccacttcagtgtccctgccgactacccacccgcgccccctgcctttccacctcgagagtactggtctgaaccatacccactgcccccacccacatcagtccttcaggagcccccagtgcagagcccaggggctggcaggagcccgtggggcagggcagacagcctggccaaggagcaggccagcgtgtatactaagctgtgtggtgtgtttcccccgcacctggtggaggctgtgatggggcgcttcccacagctcctggacccccagcagctggctgccgagatcctctcctacaagtcccagcaccccagtgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 116
- chromosome 17 open reading frame 80
- protein inhibitor of activated STAT, 3
- A kinase (PRKA) anchor protein 8-like