MRPS18B-mitochondrial ribosomal protein S18B Gene View larger

MRPS18B-mitochondrial ribosomal protein S18B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS18B-mitochondrial ribosomal protein S18B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS18B-mitochondrial ribosomal protein S18B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005373
Product type: DNA & cDNA
Ncbi symbol: MRPS18B
Origin species: Human
Product name: MRPS18B-mitochondrial ribosomal protein S18B Gene
Size: 2ug
Accessions: BC005373
Gene id: 28973
Gene description: mitochondrial ribosomal protein S18B
Synonyms: C6orf14; HSPC183; HumanS18a; MRP-S18-2; MRPS18-2; PTD017; S18amt; 28S ribosomal protein S18b, mitochondrial; 28S ribosomal protein S18-2, mitochondrial; MRP-S18-b; S18mt-b; mitochondrial ribosomal protein S18-2; mrps18-b; mitochondrial ribosomal protein S18B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgtctgtattaaacaccgtgctgaggcggcttcctatgctatctctcttccgaggttctcacagagttcaggttcccctccagactctttgcaccaaagctccctctgaggaagattctttgtcctcagttcccatttctccttataaggatgagccctggaaatatctggaatcagaagaataccaggagcgatatggttctcgccccgtctgggctgactaccgccgcaaccacaagggtggtgtacccccacagcggactcggaagacatgtattcgtcggaataaagttgttgggaatccctgccccatctgtcgagatcacaagttgcatgttgactttaggaacgtgaagctcttggagcaatttgtctgcgcccacacgggtatcatcttctatgctccatacacaggagtctgtgtgaagcagcacaagcggttgacccaggccatccagaaagccagggatcatggtctcctcatttaccacatcccccaggttgaaccacgggaccttgacttcagtacctctcatggggctgtgagtgctactccgccagcccccaccctggtctcaagtgacccctggtacccatggtacaactggaaacagccaccggagagagaactgtctcgccttcgccggctttaccagggtcatctccaagaagagagtggccccccacctgagtcaatgcccaagatgccccctagaacaccagcggaagcctcctccactgggcagacaggccctcagagtgctctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25, member 33
- solute carrier family 22, member 18
- zinc finger CCCH-type containing 12A
- chromosome 1 open reading frame 116

Buy MRPS18B-mitochondrial ribosomal protein S18B Gene now

Add to cart