PNO1-partner of NOB1 homolog (S. cerevisiae) Gene View larger

PNO1-partner of NOB1 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PNO1-partner of NOB1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PNO1-partner of NOB1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008304
Product type: DNA & cDNA
Ncbi symbol: PNO1
Origin species: Human
Product name: PNO1-partner of NOB1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC008304
Gene id: 56902
Gene description: partner of NOB1 homolog (S. cerevisiae)
Synonyms: RNA-binding protein PNO1; KHRBP1; RRP20; KH-type RNA-binding protein 1; RNA binding protein; partner of NOB1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatccgaaatggaaacgcagagcgccagggcagaggagggctttacccaggtcacccgcaagggtggccgacgggcgaagaaacgacaggctgaacagctgtccgcagcaggagagggcggggatgcgggccgcatggacacagaggaggccaggccggcgaagaggcccgtcttcccacccctctgtggggacgggctcctgagtgggaaagaagaaacaaggaaaattccagtcccagctaacagatacacaccattgaaagaaaactggatgaagatatttactcctattgtggaacatttgggacttcagatacgctttaacttgaaatcaaggaatgtagaaatcaggacttgtaaagaaaccaaggatgttagtgctctgacaaaagcagctgattttgtgaaagcttttattctcggctttcaggtggaggatgcacttgccctcatcaggttggatgacctcttcctagagtcttttgaaattacagatgttaaacccctaaagggagaccatctatccagggcaataggaagaatcgctggcaaaggaggaaaaaccaaattcaccatagagaatgtgacacggacaaggatagttttggctgatgtgaaagttcacatccttggctccttccaaaatatcaagatggcaagaactgccatttgcaacctaatcttgggaaatcctccttccaaggtttatggcaatattcgagctgtggctagcagatcagcagatcgattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S18B
- solute carrier family 25, member 33
- solute carrier family 22, member 18
- zinc finger CCCH-type containing 12A

Buy PNO1-partner of NOB1 homolog (S. cerevisiae) Gene now

Add to cart