Login to display prices
Login to display prices
PROCR-protein C receptor, endothelial (EPCR) Gene View larger

PROCR-protein C receptor, endothelial (EPCR) Gene

PTXBC014451

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PROCR-protein C receptor, endothelial (EPCR) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PROCR-protein C receptor, endothelial (EPCR) Gene

Proteogenix catalog: PTXBC014451
Ncbi symbol: PROCR
Product name: PROCR-protein C receptor, endothelial (EPCR) Gene
Size: 2ug
Accessions: BC014451
Gene id: 10544
Gene description: protein C receptor, endothelial (EPCR)
Synonyms: CCCA; CCD41; EPCR; endothelial protein C receptor; APC receptor; CD201 antigen; activated protein C receptor; cell cycle, centrosome-associated protein; centrocyclin; protein C receptor, endothelial; protein C receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgacaacattgctgccgatactgctgctgtctggctgggccttttgtagccaagacgcctcagatggcctccaaagacttcatatgctccagatctcctacttccgcgacccctatcacgtgtggtaccagggcaacgcgtcgctggggggacacctaacgcacgtgctggaaggcccagacaccaacaccacgatcattcagctgcagcccttgcaggagcccgagagctgggcgcgcacgcagagtggcctgcagtcctacctgctccagttccacggcctcgtgcgcctggtgcaccaggagcggaccttggcctttcctctgaccatccgctgcttcctgggctgtgagctgcctcccgagggctctagagcccatgtcttcttcgaagtggctgtgaatgggagctcctttgtgagtttccggccggagagagccttgtggcaggcagacacccaggtcacctccggagtggtcaccttcaccctgcagcagctcaatgcctacaaccgcactcggtatgaactgcgggaattcctggaggacacctgtgtgcagtatgtgcagaaacatatttccgcggaaaacacgaaagggagccaaacaagccgctcctacacttcgctggtcctgggcgtcctggtgggcggtttcatcattgctggtgtggctgtaggcatcttcctgtgcacaggtggacggcgatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: