Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PROCR-protein C receptor, endothelial (EPCR) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PROCR-protein C receptor, endothelial (EPCR) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014451 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PROCR |
| Origin species: | Human |
| Product name: | PROCR-protein C receptor, endothelial (EPCR) Gene |
| Size: | 2ug |
| Accessions: | BC014451 |
| Gene id: | 10544 |
| Gene description: | protein C receptor, endothelial (EPCR) |
| Synonyms: | CCCA; CCD41; EPCR; endothelial protein C receptor; APC receptor; CD201 antigen; activated protein C receptor; cell cycle, centrosome-associated protein; centrocyclin; protein C receptor, endothelial; protein C receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgacaacattgctgccgatactgctgctgtctggctgggccttttgtagccaagacgcctcagatggcctccaaagacttcatatgctccagatctcctacttccgcgacccctatcacgtgtggtaccagggcaacgcgtcgctggggggacacctaacgcacgtgctggaaggcccagacaccaacaccacgatcattcagctgcagcccttgcaggagcccgagagctgggcgcgcacgcagagtggcctgcagtcctacctgctccagttccacggcctcgtgcgcctggtgcaccaggagcggaccttggcctttcctctgaccatccgctgcttcctgggctgtgagctgcctcccgagggctctagagcccatgtcttcttcgaagtggctgtgaatgggagctcctttgtgagtttccggccggagagagccttgtggcaggcagacacccaggtcacctccggagtggtcaccttcaccctgcagcagctcaatgcctacaaccgcactcggtatgaactgcgggaattcctggaggacacctgtgtgcagtatgtgcagaaacatatttccgcggaaaacacgaaagggagccaaacaagccgctcctacacttcgctggtcctgggcgtcctggtgggcggtttcatcattgctggtgtggctgtaggcatcttcctgtgcacaggtggacggcgatgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - B-cell receptor-associated protein 29 - partner of NOB1 homolog (S. cerevisiae) - mitochondrial ribosomal protein S18B - solute carrier family 25, member 33 |